ID: 935302548

View in Genome Browser
Species Human (GRCh38)
Location 2:101705393-101705415
Sequence GTGTCTGAACACAAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935302548_935302549 -2 Left 935302548 2:101705393-101705415 CCAGCACACTTGTGTTCAGACAC 0: 1
1: 0
2: 1
3: 16
4: 149
Right 935302549 2:101705414-101705436 ACAATGAATGCACTGACACATGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935302548 Original CRISPR GTGTCTGAACACAAGTGTGC TGG (reversed) Intronic
900464640 1:2819573-2819595 GTGTGTGCACACAGGTGTGTGGG - Intergenic
902459291 1:16560696-16560718 GTGACTGAGCACCAGGGTGCCGG + Intergenic
903483639 1:23673244-23673266 GTGACTGAGCGCCAGTGTGCCGG + Intergenic
903491895 1:23735473-23735495 GTGTCTGAACACCTGGATGCAGG - Intergenic
903747538 1:25598263-25598285 GTCTCTGAAGCCAAGGGTGCAGG + Intergenic
906512510 1:46418640-46418662 CTCTCTGACCACCAGTGTGCTGG + Intergenic
909929111 1:81474510-81474532 TTTTCTGAACACAAGTGTCCAGG - Intronic
909949427 1:81702242-81702264 GGGTCTGACCACAAGTAGGCAGG + Intronic
910493355 1:87797805-87797827 ATTTCTGAGCACTAGTGTGCAGG - Intergenic
912488282 1:110046583-110046605 GTGTTTGAAGACAAATGTGTGGG + Intronic
912902043 1:113661669-113661691 GTGTCTGTCCACAAGTGTTTGGG - Intronic
915646367 1:157275594-157275616 GTGTTTACACAGAAGTGTGCAGG + Intergenic
920172812 1:204082252-204082274 GTGTGTGCACATATGTGTGCAGG + Intronic
920190604 1:204191301-204191323 GTGTTGGAACACAGGTGTGTGGG - Intronic
924597560 1:245460766-245460788 GTGTAAGCACACATGTGTGCAGG - Intronic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
924944344 1:248836053-248836075 GTGTTTGAACAGAAGTCTGAAGG + Intergenic
1063041475 10:2342756-2342778 GGGTCTGAGCACCAGTGTGTAGG + Intergenic
1063270514 10:4505017-4505039 GCGTATATACACAAGTGTGCAGG - Intergenic
1065121680 10:22536803-22536825 GTGAATGAACACACGTGTGGGGG - Exonic
1065948658 10:30629865-30629887 GCTTCAGAACACAAGCGTGCAGG - Intergenic
1069889355 10:71643635-71643657 GAGTGTGCACACATGTGTGCTGG - Intronic
1070261469 10:74859908-74859930 GTGTATGAACACAAGCCTGCAGG + Intronic
1072587883 10:96798751-96798773 GTGTTTGAGCACAAGGGTGTTGG + Intergenic
1072860998 10:99006122-99006144 GTCTCTGAGCCCAAGTCTGCAGG + Intronic
1073186366 10:101617600-101617622 GTGTCTGAACACATGTGCGTGGG - Intronic
1077910184 11:6566416-6566438 GTGTGTCCACACAACTGTGCTGG - Intronic
1081029507 11:38060759-38060781 GTGTCTGTACATATGTGTGTAGG + Intergenic
1081616768 11:44595999-44596021 GTGTATGAACACTTGTGTGCGGG - Intronic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1083751460 11:64763150-64763172 GTGTCTTAAGACAGGTGGGCAGG + Intergenic
1084947766 11:72648027-72648049 GTGTGTGTACACAAGTGTCCAGG + Intronic
1085411005 11:76290559-76290581 GCATTTGTACACAAGTGTGCGGG - Intergenic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1096510116 12:52123100-52123122 GTGTCTGGTCACGAGTGTCCTGG + Intergenic
1097649108 12:62274102-62274124 GAGTCTGAAAACTAGAGTGCGGG + Intronic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1100719226 12:97339663-97339685 GTGTGTGCACGCACGTGTGCAGG + Intergenic
1101579359 12:106027816-106027838 GTGTATGAATACATGTGTGTTGG - Intergenic
1102040103 12:109795254-109795276 CTGTATGAATACAATTGTGCAGG - Intronic
1102085469 12:110134667-110134689 GAATCAGAACACAAATGTGCTGG + Intronic
1102974564 12:117197152-117197174 GTGTCTTAACACACGTCTGTGGG - Intergenic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1103614305 12:122142411-122142433 GTTTCTGCACACATGTGTCCTGG - Exonic
1104000373 12:124856395-124856417 GTGTTTGCACACACGTGTGTTGG - Intronic
1106227729 13:27797461-27797483 GTGTTTGAGCGAAAGTGTGCTGG - Intergenic
1106464439 13:30000035-30000057 ATTTCTGAAAACATGTGTGCCGG - Intergenic
1106513263 13:30429860-30429882 GTGTCTGAACAGAAGGGGGTGGG + Intergenic
1107749696 13:43551790-43551812 GTGTGTGGACACAATTGTGCTGG - Intronic
1111265073 13:85799692-85799714 GTGTTTGCACACATGTGTGCAGG + Intergenic
1112783923 13:102930884-102930906 CTGTCTGCAGACAAGTGTCCTGG - Intergenic
1115618256 14:35116852-35116874 GTGTCTAAGCACAATTGTGAAGG - Intronic
1119474512 14:74919437-74919459 GTGTGTGCACACAAGGGTGTCGG + Intronic
1121107213 14:91289018-91289040 GTGGCTGTGCACACGTGTGCAGG - Intronic
1122850600 14:104527358-104527380 GTGTCTGAATGCATGTGTGTGGG - Intronic
1124567108 15:30826515-30826537 GGGTCTGACCACTAGTGTACTGG + Intergenic
1128541153 15:68534263-68534285 GTGTGTGTACACATATGTGCAGG - Intergenic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1130012643 15:80163512-80163534 GTGTCTGAAACCGAGTGTGGGGG + Intronic
1133325719 16:4941015-4941037 GTTTCAGAACACAGGTGTGCGGG + Intronic
1135276668 16:21119193-21119215 GTGACAGATCACAAGTGGGCAGG + Intronic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1137555713 16:49469084-49469106 GTGTCTGTGCACACATGTGCAGG - Intergenic
1138132168 16:54489668-54489690 TTGACTGAACACATCTGTGCTGG - Intergenic
1140817446 16:78634182-78634204 GTGTCTAAATACAAATGTCCAGG + Intronic
1141106968 16:81241879-81241901 GTCTCAGAACACACGTGTGTCGG - Intronic
1142195050 16:88735661-88735683 GTGTCTGGACACCTGTTTGCAGG - Intronic
1142468595 17:149391-149413 GTGTGTGAACAGAAGTGCGGTGG - Intronic
1145768411 17:27475259-27475281 GTCTCTGAGCACAGGTGTGAAGG + Intronic
1146575187 17:33984827-33984849 GTTTCTGAGCACAAGAGTGGAGG + Intronic
1146969725 17:37062881-37062903 GTGCCTCAGCACAACTGTGCAGG + Intergenic
1147419661 17:40316184-40316206 GTGTTTGTACACACGGGTGCTGG + Intronic
1148844207 17:50519153-50519175 GTGTCTGGACACAGGGATGCTGG + Intronic
1152741603 17:82020846-82020868 GTGTGTGAACACAGGAGTGGTGG + Intronic
1153910452 18:9702032-9702054 GACACTGAACACAAGTGTGCAGG + Intergenic
1158544636 18:58385753-58385775 GTGGCTGAACACTCTTGTGCTGG - Intronic
1159371132 18:67528849-67528871 GTGGCTTAACATATGTGTGCTGG - Intergenic
1160618447 18:80151675-80151697 TTGTCTGGACAAAAGGGTGCAGG + Intronic
1161744692 19:6048798-6048820 GTGTTTGAATTCGAGTGTGCTGG + Intronic
1163380087 19:16960310-16960332 GTGTTTGCACACACGTCTGCGGG - Intronic
1164504549 19:28848582-28848604 GTGTCTAAACACAAGCTTTCGGG - Intergenic
1166713956 19:44954881-44954903 GGGTCAGAAGACAAGGGTGCTGG + Intronic
1167603886 19:50469792-50469814 GTGTCTGTGCACAGGTGTGAGGG - Intronic
1202675535 1_KI270711v1_random:2880-2902 GTGACTGAGCACCAGGGTGCCGG + Intergenic
926164606 2:10513274-10513296 GTGTGTGCACACAAATGTGGGGG - Intergenic
927462956 2:23315092-23315114 GTGTCTGAACCCAAGTTTCTGGG - Intergenic
929904907 2:46037053-46037075 GGGGCTGAACCCAAGTGTCCTGG - Intronic
932297957 2:70642454-70642476 GTGTATGAATGCAAGTCTGCTGG + Intronic
934528503 2:95068722-95068744 GTGTCTGAAAACAAGCTTGTGGG - Intergenic
935224348 2:101040114-101040136 TTGTTTGAACACAAGGTTGCTGG - Intronic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
935484459 2:103636156-103636178 GTTTCTGAATACAGATGTGCTGG - Intergenic
943821585 2:192330013-192330035 TTGTGTGATCACAAGCGTGCAGG + Intergenic
948755381 2:240156630-240156652 GTGTGTGCACACAATTGAGCAGG - Intergenic
1169106365 20:2998665-2998687 GTGACTGAACACTAGAGTGATGG - Intronic
1170118882 20:12891378-12891400 GCTTCTGCTCACAAGTGTGCAGG + Intergenic
1174639511 20:52031382-52031404 GTGTGTGACCACAAGGGTGATGG - Intergenic
1175610473 20:60347226-60347248 TAGTCTGAACACAAGTGTCCAGG + Intergenic
1176154789 20:63613471-63613493 GTGTACGAAGACAACTGTGCAGG + Intronic
1177781862 21:25630467-25630489 GTTTCTGAAAACAGGTGTGGAGG + Intergenic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1183768403 22:39900893-39900915 TTATGTGAACACAAGTGTTCAGG + Intergenic
950500845 3:13362660-13362682 GTGTGTGAGCACACATGTGCAGG - Intronic
950897918 3:16470065-16470087 GTGTCAGAACACAAGTTTCTGGG - Intronic
951508045 3:23470934-23470956 GTGTCGGAACATAACTGTCCAGG - Intronic
955952174 3:64253379-64253401 GTGTCTGAACAGCTGTGTGATGG - Intronic
959348689 3:105232672-105232694 GAGTCTGAACATAAGTTTTCTGG + Intergenic
960202003 3:114848248-114848270 GTGTCTGAACACATGCGGGCAGG + Intronic
961716523 3:128861356-128861378 GTGTGTGAGCACATGTGTGATGG - Intergenic
964413595 3:156424876-156424898 GTGTCTTATTACAAGTGTTCAGG - Intronic
965185815 3:165461660-165461682 GTGTCTGAACTCAGTTGTCCTGG + Intergenic
965354741 3:167659683-167659705 GTGACTGAAAACAAGGATGCTGG - Intergenic
968083627 3:195863967-195863989 GGGACTGAACCAAAGTGTGCAGG + Exonic
968610282 4:1553961-1553983 ATGTCTGAACAAAAGGGTGGAGG - Intergenic
968654418 4:1772425-1772447 GTCTTTGGACACAAGTGTGTGGG - Intergenic
968985563 4:3872631-3872653 GAGACTGCAGACAAGTGTGCCGG - Intergenic
969353296 4:6610722-6610744 GTGTCTGAACCCCAGTCTGTTGG + Intronic
971443843 4:26720757-26720779 GGATCTGAACCCAAGTCTGCTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974439185 4:61895069-61895091 GAGTCTTAAAATAAGTGTGCAGG - Intronic
975047047 4:69818235-69818257 CAGACTGAACACAAGTGTCCTGG + Intronic
975912267 4:79280932-79280954 GTTTCTGCACACAAGGTTGCAGG + Intronic
979234265 4:118382043-118382065 GTATCTCAACACAAATGTGACGG + Intergenic
982917979 4:161238036-161238058 GTGTGTGCACTCATGTGTGCCGG + Intergenic
984461012 4:180036529-180036551 GTCTCTGGAAATAAGTGTGCTGG + Intergenic
985838920 5:2291159-2291181 CTGGCTGAACACATGTGTACTGG - Intergenic
986207007 5:5634390-5634412 GTGTCTGAACAGCACTGTGCAGG - Intergenic
986703266 5:10432458-10432480 GTGGCTGGGCACAAGTGTGAAGG - Intronic
988563261 5:32299780-32299802 GTGTGTGCACACATGTGTGATGG - Intronic
994269078 5:97755105-97755127 GTGTCTGTACATAGGTGTGCAGG - Intergenic
994851667 5:105062434-105062456 GTGTGTGTGCACATGTGTGCAGG + Intergenic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
1000760147 5:165213498-165213520 GTGTATGTGCACATGTGTGCTGG - Intergenic
1001175453 5:169464326-169464348 GTGTCTGATCACAATTGTATTGG + Intergenic
1004631231 6:17423237-17423259 CTGTGTGAGCACAAATGTGCTGG + Intronic
1009457310 6:63872320-63872342 GTGTGTGTGCACAAGTGTGTAGG + Intronic
1011622024 6:89252011-89252033 GTGTCTGAGGACAAGTGTGCTGG - Intergenic
1013270984 6:108545194-108545216 GCATCTGACCACAAGTGTTCTGG - Intergenic
1017620544 6:156292170-156292192 CTGTCTGCTCACAAGGGTGCAGG - Intergenic
1019021869 6:168925660-168925682 AGCTCTGAACACAAATGTGCTGG + Intergenic
1019220819 6:170471355-170471377 TGATCTGAACACATGTGTGCTGG + Intergenic
1019295734 7:273049-273071 GTGTGTGCACACGAGTGTGTGGG - Intergenic
1021321165 7:19213917-19213939 ATGTGTCAACACAATTGTGCAGG - Intergenic
1023620614 7:42068121-42068143 GTGTGTCTACACACGTGTGCAGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1024107691 7:46109609-46109631 GTGTTGGAACACAAGTGGGAGGG - Intergenic
1030494411 7:110279913-110279935 GGGTTGGAACACAAGGGTGCAGG + Intergenic
1030624374 7:111828245-111828267 GTATCAGAACACAAGTATGTGGG - Intronic
1034491052 7:151393294-151393316 GTGTGTGCACACAGGTGTGTGGG + Intronic
1035098471 7:156376932-156376954 GTGTGTGCACACATATGTGCAGG - Intergenic
1035926205 8:3730392-3730414 GTGTCTGATCACCACTGAGCTGG + Intronic
1037675859 8:21050275-21050297 CTGTCTGAAGACAAGTGGGTGGG - Intergenic
1039416634 8:37400559-37400581 GTGGCAGAAGACAAGAGTGCGGG - Intergenic
1051774749 9:20621730-20621752 GTGTGTGAGCCGAAGTGTGCGGG - Intronic
1055129213 9:72754889-72754911 GTGTCTCCACACAAGTGTATTGG + Intronic
1055330045 9:75174207-75174229 TTGCCTTAACACAAGTCTGCAGG + Intergenic
1056787232 9:89602111-89602133 GTGTCTGAACTGAAGGGTGGTGG + Intergenic
1060522702 9:124302756-124302778 GTGTGTGGACACAGGTGTGCGGG - Intronic
1185633879 X:1537279-1537301 CTGTCTGAACACTCATGTGCAGG + Intergenic
1187309128 X:18123793-18123815 GTATGTGAACAGATGTGTGCAGG - Intergenic
1187644176 X:21328588-21328610 CTGCCTGCACACAAATGTGCTGG - Intergenic
1188535006 X:31186940-31186962 GTATCTGGACACAGGTGTTCAGG - Intronic
1190528295 X:51349955-51349977 GTGTCTGACCAGATGTGTTCAGG + Intergenic
1191816817 X:65254160-65254182 GTGTCTGTGCACATTTGTGCTGG - Intergenic
1199400174 X:147389719-147389741 CTGTCTGAACACATGCATGCTGG - Intergenic
1201984296 Y:19947772-19947794 GGGTCTGAGAACAAGTCTGCTGG - Intergenic