ID: 935304912

View in Genome Browser
Species Human (GRCh38)
Location 2:101728087-101728109
Sequence CTGTACTTAAAGAGGTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935304912_935304919 29 Left 935304912 2:101728087-101728109 CCAGGTTACCTCTTTAAGTACAG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 935304919 2:101728139-101728161 TCTAGAATGCTCTTGAAGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935304912 Original CRISPR CTGTACTTAAAGAGGTAACC TGG (reversed) Intronic
900922534 1:5682586-5682608 CTGTACTTGCAGACGCAACCTGG - Intergenic
901956341 1:12788321-12788343 CTGGACCTAAAGAGGCACCCTGG - Intergenic
901959204 1:12810949-12810971 CTGGACCTAAAGAGGCAACCGGG - Intergenic
901979722 1:13024376-13024398 CTGGACCTAAAGAGGCACCCTGG - Intronic
902002361 1:13204562-13204584 CTGGACCTAAAGAGGCACCCTGG + Intergenic
902021590 1:13350326-13350348 CTGGACCTAAAGAGGCACCCTGG + Intergenic
910068235 1:83179871-83179893 ATGTACTTAATGATGTAAACTGG + Intergenic
921259164 1:213370312-213370334 ATGTTCTTAAAGATGTATCCTGG - Intergenic
922350800 1:224733348-224733370 CTCCACTTAATGAGGTCACCTGG + Intronic
924016212 1:239726522-239726544 CTATACCTAAAGAGGTTATCAGG + Intronic
1080113895 11:28600516-28600538 CTTTACTTAAAGGGGTAACATGG + Intergenic
1081794532 11:45810487-45810509 TTGTAATTAAAGAAGTAACTGGG + Intronic
1084423707 11:69072988-69073010 GTGTGGTTAAAGAGGTAACTGGG + Exonic
1086596912 11:88583532-88583554 CTGTCTTTCAAGAAGTAACCAGG - Intronic
1089866462 11:121637288-121637310 CTGTATTGAAAAAGGTAAACTGG - Intergenic
1093836387 12:23834722-23834744 CAGTTCTTAAAGAGGTAAGAAGG + Intronic
1095144774 12:38712777-38712799 CTGGACTGAAAGAAGTATCCTGG + Intronic
1095985650 12:47997774-47997796 CTGCTCTTTAAGAGGTGACCAGG + Intronic
1097376319 12:58847634-58847656 CTCTATTTAAAAAGGTAACATGG + Intergenic
1102005482 12:109586786-109586808 TCATCCTTAAAGAGGTAACCTGG + Exonic
1106393797 13:29360823-29360845 TTGTACCTAAAGAGGAAAACAGG + Intronic
1107136355 13:36948102-36948124 CTGTGCTTAGAAAGGTAAGCTGG + Intergenic
1110070097 13:71164373-71164395 CTCGAATTAAAGAGGAAACCAGG + Intergenic
1113280280 13:108780990-108781012 CTGTGCTTAAAGAAGTCATCAGG - Intronic
1113803390 13:113097896-113097918 CTGTACTCAAGGTGGTCACCAGG - Intronic
1119234119 14:73005363-73005385 CTGGAGTTAAATAGGTTACCTGG + Intronic
1121825997 14:97009932-97009954 CTGTTCTTAAACATGGAACCTGG - Intergenic
1122024315 14:98864127-98864149 ATGTACTTGAAGGGGCAACCTGG - Intergenic
1126102617 15:45129102-45129124 GTGTGATTAAAGAGGGAACCAGG + Exonic
1131101580 15:89694533-89694555 CAGTAATAAAAGAAGTAACCCGG - Intronic
1137479266 16:48837872-48837894 CTGGACTTAAAGAGGTAGAGAGG - Intergenic
1139296055 16:65901903-65901925 TTATACTATAAGAGGTAACCTGG + Intergenic
1141607653 16:85163976-85163998 CTGTATTTAAAAAGGCAACAAGG + Intergenic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1152454700 17:80407198-80407220 CTGCAGCTAAAGAGTTAACCTGG - Intergenic
1155727394 18:29104932-29104954 TTGTACTTACTGAGGTAACCAGG - Intergenic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1160041022 18:75345624-75345646 CTGTACTCAACCAGGTAATCTGG - Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
926708840 2:15859033-15859055 CTGTGCTTTTAGAGGTCACCTGG - Intergenic
929306008 2:40362364-40362386 TTGTACTTAAAAAGGTATACAGG + Intronic
933009728 2:77045064-77045086 CTTTACATAAAGAGGTAATATGG + Intronic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
935651810 2:105388519-105388541 CTGTTCTTAAATAGGTACACTGG + Intronic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
939756445 2:146118246-146118268 CTGTACTTAAAGATCTAAATAGG + Intergenic
939976237 2:148720188-148720210 CTTCACTTAAAGAAGTAATCTGG + Intronic
942158339 2:173155598-173155620 CTGTACTGAAACAGTTAACATGG - Intronic
943732644 2:191319244-191319266 CTTTACTTAGAGTGGCAACCAGG + Intronic
945232470 2:207607077-207607099 CTGTATTTCAAGTGGTAACATGG - Intronic
1169653766 20:7898899-7898921 CTGTACATAACTAGATAACCAGG - Intronic
1170630684 20:18062140-18062162 CTATATTTAAAGAGGTAACAAGG - Intergenic
1170698692 20:18683935-18683957 CTCTACTTAGATAGGTATCCTGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175499303 20:59438514-59438536 CTGTAATTAAACAGCCAACCTGG + Intergenic
1176276334 20:64271960-64271982 CTGTACTTGAGGAGGGAGCCGGG + Intronic
1177907254 21:26986973-26986995 ATGAAGTTTAAGAGGTAACCTGG - Intergenic
1178494077 21:33071972-33071994 ATTTACTAAAATAGGTAACCAGG + Exonic
1181097117 22:20513038-20513060 CTGTAATACAAGAGGTGACCCGG - Intronic
1183927954 22:41219237-41219259 CTGTCCTTGAAGAGCTAAGCCGG - Intronic
952861185 3:37813707-37813729 CTGTTCTTGATGAGGTAATCAGG + Intronic
955744158 3:62123707-62123729 CTCTAATTAAAGAGTTAACAAGG + Intronic
955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG + Intronic
958028393 3:88076379-88076401 CTGTACTTAAAGATGAAAATGGG - Intronic
958193116 3:90208627-90208649 CTGTTGTTAAAGAGCAAACCGGG - Intergenic
958681146 3:97333078-97333100 CTGTTCATAAACAGGTAACTAGG - Intronic
960418088 3:117409824-117409846 CTCTCCTTAAATAGGTGACCAGG + Intergenic
962505870 3:136045804-136045826 CTGTAATTCAAGCTGTAACCTGG - Intronic
962623532 3:137202325-137202347 ATGTACCAGAAGAGGTAACCAGG - Intergenic
963000336 3:140674810-140674832 TTGTACTTGAAGATCTAACCAGG + Intergenic
963133384 3:141877573-141877595 CTGTAATTAAAAAGGAATCCGGG - Intronic
966074024 3:175914409-175914431 ATGTTCTTAATGAGGAAACCAGG - Intergenic
968027500 3:195454818-195454840 CAGCAATTAAAAAGGTAACCTGG + Intergenic
969470991 4:7389237-7389259 CTGTTCTTAAAGAGTTACACTGG - Intronic
972287325 4:37661578-37661600 CTGTATTTAAAGAATTAACTTGG - Intronic
972814680 4:42631037-42631059 TTATACTTAAAGAGCTAACAGGG + Intronic
987087279 5:14482744-14482766 CTGTTCTTAAACAGGAATCCCGG - Exonic
988057444 5:26117412-26117434 CCATACTTATAGTGGTAACCAGG - Intergenic
988905051 5:35779099-35779121 CTGTACTGAAAGTGGTAAAATGG - Exonic
990118459 5:52419023-52419045 CTGTTCTCAGAAAGGTAACCAGG - Intergenic
990118620 5:52421403-52421425 CTGTTCTCAGAAAGGTAACCAGG - Intergenic
992091016 5:73317077-73317099 CTGTACTAAAAGAAATATCCGGG + Intergenic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
993640625 5:90401072-90401094 ATGTACTTAAAGAAGCAACAGGG + Intronic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
1002588679 5:180271477-180271499 TGTTACTTAAAGACGTAACCAGG - Intronic
1002823004 6:745893-745915 ATGAAGTTAAAGAGTTAACCTGG + Intergenic
1003347818 6:5287083-5287105 CTTTACCTAAAGAGCTAACCAGG - Intronic
1004147457 6:13081527-13081549 GTGTACTTAAAGAAGCAGCCAGG + Intronic
1010462268 6:76126860-76126882 CTGCACTTGAAGAGGTCACTTGG + Intergenic
1010777313 6:79902185-79902207 CTGTAGTGAAGGCGGTAACCAGG + Intergenic
1011843088 6:91526648-91526670 CTGTACAAAAAGAGGTAGCTGGG - Intergenic
1015871871 6:137783750-137783772 CTCTATTTAAAGAGATCACCAGG - Intergenic
1016737956 6:147500881-147500903 CAGTACATAAAGTGGAAACCAGG + Intergenic
1018523224 6:164676805-164676827 CTCAACTTAGAGAGGCAACCAGG + Intergenic
1019497858 7:1348822-1348844 GTGCAATTAAAGAGGTAATCGGG - Intergenic
1023708199 7:42964465-42964487 CTGTAGATAATGAGGTAACAGGG + Intergenic
1026894883 7:74004235-74004257 CTGTAGTTAAAGGTGTACCCTGG + Intergenic
1027275863 7:76554902-76554924 ATGTACTTAATGATGTAAACTGG - Intergenic
1033709722 7:143929843-143929865 CTGTCCTCAAAGAGCTGACCTGG - Intergenic
1034643230 7:152621396-152621418 CTGCATTTAATGAGGTCACCTGG + Intergenic
1034709530 7:153178564-153178586 CTGTACTTGAACATGTAAACTGG + Intergenic
1035490885 7:159277203-159277225 ATATACTTAAAGAGCTAACATGG - Intergenic
1039136147 8:34324919-34324941 CTGTAATTAAATAGGTAAAATGG - Intergenic
1039177253 8:34823802-34823824 CTGGTATTAAAGATGTAACCAGG + Intergenic
1042966096 8:74354149-74354171 CTATAGTTGAAGAGGTAATCTGG - Intronic
1046434577 8:114170472-114170494 CTGCACTTATATAAGTAACCAGG - Intergenic
1048067695 8:130987350-130987372 CTGGCCTTAAAGAGTTTACCAGG - Intronic
1050236725 9:3589247-3589269 CTGTATTTCCAGAGGTAACCTGG + Intergenic
1055037719 9:71836196-71836218 CTGTAAAGAAAGAGGTAGCCAGG - Intergenic
1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG + Intergenic
1061388168 9:130302715-130302737 CTGAGCTTAGAGAGGTGACCAGG + Intronic
1185469872 X:375875-375897 TTGTACGGAAAGAGGAAACCTGG - Intronic
1185515317 X:695011-695033 CTGTCCTTTTAAAGGTAACCTGG - Intergenic
1185561813 X:1065753-1065775 CTGTACTCAGAGAGGCAACGTGG - Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188200198 X:27287239-27287261 CTGCAGTTAAAGAGTTAACCTGG + Intergenic
1192165794 X:68826984-68827006 CTGTCCTTCAAGAGGTTGCCAGG - Intergenic
1193289269 X:79752899-79752921 CTGCAGTTAAAGAGAGAACCAGG - Intergenic
1195010684 X:100730209-100730231 GTGTACTTATAGTGGTAACGTGG + Intronic
1195685458 X:107580854-107580876 CTGTATTTAAAGCGGCAACATGG + Intronic
1196283100 X:113846960-113846982 CTATTCTTAACCAGGTAACCAGG + Intergenic
1198693063 X:139305315-139305337 CAGTACTTAAAGTGGTAAAGTGG - Intergenic