ID: 935306905

View in Genome Browser
Species Human (GRCh38)
Location 2:101745896-101745918
Sequence CACGGCAGAGAACCAAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935306905 Original CRISPR CACGGCAGAGAACCAAATGG GGG (reversed) Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
905257145 1:36692162-36692184 CGGGGCAGAGAACAATATGGAGG - Intergenic
912578758 1:110701298-110701320 CACAGCAGAGAATTAAATGCTGG - Intergenic
915465756 1:156096992-156097014 CACGGCAGGGAAGGAAGTGGTGG + Intronic
919268821 1:195311739-195311761 CACAGCAGAGAAACTAATGGTGG - Intergenic
1063256173 10:4329636-4329658 CATGGCAGAGCACCATATGTGGG - Intergenic
1066393588 10:34998263-34998285 CATGACAGAGATCCAAGTGGAGG - Intergenic
1068879870 10:62036693-62036715 CCCTGCAGAGACCCAAATGGAGG + Intronic
1069307000 10:66983198-66983220 CTCGGCAGAAAGACAAATGGAGG + Intronic
1071064959 10:81620688-81620710 CACTACAGAGAACCATTTGGAGG - Intergenic
1074101844 10:110359948-110359970 CCAGGTAGAAAACCAAATGGGGG + Intergenic
1077486039 11:2838867-2838889 AGCGGCAGAGAATCAAATGCAGG + Intronic
1077708487 11:4512088-4512110 TTCTGCAGAGAAGCAAATGGAGG + Intergenic
1078973970 11:16449621-16449643 CATGGCAGGCAACCAATTGGAGG - Intronic
1083198784 11:61106958-61106980 CACAGCAGTGAACAAAACGGTGG + Intronic
1084441254 11:69174838-69174860 CAATGCAGTGCACCAAATGGAGG - Intergenic
1086404048 11:86485145-86485167 CATGGAAAAGAACCAATTGGTGG - Intronic
1089221452 11:116875376-116875398 CAACCCAGAGAACCAAATTGTGG - Exonic
1089333805 11:117708826-117708848 CATGGCAGAGTACAAAGTGGGGG + Intronic
1090744781 11:129696853-129696875 CATGACAGAGGACCAAATGTGGG - Intergenic
1091831662 12:3554605-3554627 CACTGCAGAGTTCCAAAAGGTGG + Intronic
1092247076 12:6869662-6869684 CAGGGCAGAGATACAGATGGAGG - Intronic
1094632173 12:32186640-32186662 GAGTGCAGAAAACCAAATGGTGG + Intronic
1096382775 12:51172946-51172968 CACGGCTTAGAACCAAATCCAGG + Intronic
1103598877 12:122041444-122041466 AACAGCAGAGACCCAAGTGGAGG - Intronic
1104872095 12:132007215-132007237 CACGGCTGAGAGCCCAACGGCGG - Intronic
1106085877 13:26541180-26541202 CAAGGCAGAGATCCAACTGAGGG + Intergenic
1107394475 13:40000931-40000953 CACGATAGAGAACCCAATGGTGG + Intergenic
1121781483 14:96624994-96625016 CACAGCAGAGAGCCAGATGGCGG - Intergenic
1128772590 15:70293235-70293257 CACGGAAAAGAATCAAAAGGAGG + Intergenic
1132648933 16:1011823-1011845 CAGGGCAGAGAGACAAACGGGGG + Intergenic
1134346065 16:13393049-13393071 CACTGATGGGAACCAAATGGAGG + Intergenic
1135676449 16:24418864-24418886 CACAGCAGAGAACAAAACGGTGG + Intergenic
1142157145 16:88537742-88537764 CTCAGCAGAGAACCAGCTGGGGG - Intergenic
1147141999 17:38465400-38465422 CAAGGCAAAGAACCAAAGGGTGG - Intronic
1157202549 18:45671625-45671647 CAGGGCAGAGAACAGAATGAGGG - Intronic
1157485615 18:48084794-48084816 CAAGGCAGAGACAGAAATGGTGG + Intronic
1161169372 19:2805320-2805342 CACGGCAGAGCCCCACAGGGAGG - Intronic
1163228996 19:15986955-15986977 CACTGCAGAGAACAGCATGGAGG + Intergenic
1165084365 19:33333120-33333142 CACTGCAGAAAACAATATGGTGG + Intergenic
1166929683 19:46294753-46294775 CACAGCAGAGAGCCAATCGGAGG - Intergenic
1168608099 19:57775925-57775947 CACCACAGAGAGCCACATGGGGG - Intronic
1168620831 19:57878226-57878248 CACCACAGAGAGCCACATGGGGG + Intronic
926366852 2:12141080-12141102 CAGGCCAGAGGCCCAAATGGAGG - Intergenic
929312892 2:40445999-40446021 CACAGCAGAGAACCAAAGGGTGG + Intronic
930312414 2:49757874-49757896 CACTGCAGAAAACTAGATGGGGG + Intergenic
931432865 2:62222727-62222749 CAACGCAGGGAACCAAACGGTGG + Exonic
932824723 2:74928799-74928821 CAAGACAGAGAACCAGGTGGAGG + Intergenic
935306905 2:101745896-101745918 CACGGCAGAGAACCAAATGGGGG - Intronic
936032513 2:109083721-109083743 CACGGCAGAAAACAGGATGGTGG - Intergenic
937096041 2:119235836-119235858 CTCGGCAGGGAACCAGATGTTGG + Intronic
947632380 2:231662484-231662506 CGCGGCGGAGCACGAAATGGCGG - Intergenic
948012715 2:234662804-234662826 CAAGGCATAGAAGCAAATGTTGG - Intergenic
1170442061 20:16389256-16389278 CACAGCAGAGAATCAAATATGGG - Intronic
1174665416 20:52253616-52253638 CGAGGCAGAGAACCACAGGGAGG - Intergenic
1175759412 20:61550722-61550744 CAGTGCAGAGAGCCACATGGTGG + Intronic
1183426739 22:37743926-37743948 CACAGCAGAGAACCATCAGGGGG + Intronic
1184433571 22:44456211-44456233 CAGGGCAGAGAGTGAAATGGAGG + Intergenic
953332940 3:42069643-42069665 CACTGCAGAGAATCACATGGTGG - Intronic
953380085 3:42463459-42463481 CAAGGCACAGAACCAAATTCAGG + Intergenic
954191055 3:48961469-48961491 CAAAGCAGAGAACCAAGAGGAGG + Intronic
956446872 3:69334325-69334347 CACGGGAGAAAATAAAATGGTGG + Intronic
957021210 3:75129318-75129340 CAGGGCAGACAGCCAAAAGGGGG + Intergenic
959817895 3:110697383-110697405 TAAAGCAGAGAACCAAATCGAGG - Intergenic
960090381 3:113632686-113632708 CACGTCAGTGAACAAAATGCCGG + Intergenic
962137819 3:132756207-132756229 GACAGCAGAGAACCAAAAGAAGG + Intergenic
967723261 3:192837534-192837556 CCTGGGAGAGAACCGAATGGAGG + Intronic
968074839 3:195810581-195810603 CAAGGCCGTGACCCAAATGGAGG + Intronic
971175406 4:24277758-24277780 GAGGACAGAGTACCAAATGGGGG + Intergenic
973594955 4:52478595-52478617 CACGTCAGTGAAACAAATGCAGG + Intergenic
982093620 4:151900472-151900494 CAGGGGAGAGAATCCAATGGTGG + Intergenic
983807573 4:172014290-172014312 CACCACAGAGAACAGAATGGAGG - Intronic
986705107 5:10448095-10448117 TAAGTCAGAGAACCAAGTGGAGG + Intronic
990598536 5:57334544-57334566 CAGGGTAGAGAACAAAAAGGAGG - Intergenic
996411297 5:123162179-123162201 CACGCCAGAGATCCAGATCGAGG - Intronic
1001319800 5:170671099-170671121 CAATGCAGAGAACAGAATGGGGG - Intronic
1006818053 6:36866956-36866978 CAGGGCAGAGAGTCCAATGGTGG + Intronic
1013598542 6:111683173-111683195 CCCAACAGAGAACTAAATGGTGG + Intronic
1014195591 6:118554784-118554806 CATGGCAGACAATCAAAAGGTGG + Intronic
1016191439 6:141271366-141271388 GAGGTCAGAGAACCAAAGGGTGG - Intergenic
1019499699 7:1358760-1358782 CAGGGCAGAGAAGCAGAGGGTGG - Intergenic
1021841860 7:24727413-24727435 CATGACAGAGAGCCAAAAGGTGG + Intronic
1024283774 7:47739666-47739688 CACTGCAGAGAAAGAACTGGAGG - Intronic
1031750909 7:125572671-125572693 CAGGACAGAGAAGCAAATGCAGG + Intergenic
1034107740 7:148505174-148505196 CACAGCAGTGAACCAGATGGAGG - Intergenic
1034694468 7:153041746-153041768 CATGGCAGAGAAGCAATGGGGGG - Intergenic
1035370956 7:158378594-158378616 CAAGGCAGAGAACCAAGAGTGGG - Intronic
1037022953 8:13996796-13996818 CACTTCAGAGAACGAAATAGTGG + Intergenic
1038063121 8:23934316-23934338 CATGGCAGAGAAAGAAAAGGAGG + Intergenic
1038681441 8:29672011-29672033 CACAGCAGAAAATCAAATGAGGG - Intergenic
1038904570 8:31884829-31884851 CACTGAAGAGAACCAAAAGTAGG + Intronic
1039884895 8:41649218-41649240 CAAGGCAGAGTAGCAAATGGGGG + Intronic
1044097178 8:88080912-88080934 AAAGGCAGAGAAAGAAATGGTGG + Intronic
1046751058 8:117927026-117927048 CACAGCAGAGAACCCAAAAGAGG - Intronic
1051507113 9:17839472-17839494 CACGGCAAATAAACAAATGATGG - Intergenic
1051763117 9:20490617-20490639 CACAGCAGAGAAACAAGTTGGGG + Intronic
1054822964 9:69542427-69542449 CAAGGCAGAGAAAGACATGGAGG - Intronic
1057090923 9:92257518-92257540 CTTGGCAGAGAACCACATGCAGG + Intronic
1057217731 9:93238737-93238759 CACGTCAGGGCTCCAAATGGAGG - Intronic
1058252862 9:102723447-102723469 CACTGTAGAGAACAATATGGAGG + Intergenic
1060605655 9:124911566-124911588 CACTGCAGAGTACAAAATGGTGG + Intronic
1197226661 X:123961522-123961544 GAAGGCAGAGAGCAAAATGGTGG + Intronic
1200709122 Y:6468156-6468178 CTCAGCAGAGAACCAATTTGAGG + Intergenic
1201024990 Y:9696553-9696575 CTCAGCAGAGAACCAATTTGAGG - Intergenic