ID: 935308826

View in Genome Browser
Species Human (GRCh38)
Location 2:101762558-101762580
Sequence CAGCTCTTGTAGAGGTAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935308824_935308826 -7 Left 935308824 2:101762542-101762564 CCATCTGCTGAGTTGTCAGCTCT 0: 1
1: 0
2: 2
3: 20
4: 235
Right 935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG 0: 1
1: 0
2: 2
3: 9
4: 224
935308823_935308826 18 Left 935308823 2:101762517-101762539 CCTGAGTACAGAAGTACTTTTGA 0: 1
1: 0
2: 1
3: 18
4: 135
Right 935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG 0: 1
1: 0
2: 2
3: 9
4: 224
935308820_935308826 28 Left 935308820 2:101762507-101762529 CCCATTCAACCCTGAGTACAGAA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG 0: 1
1: 0
2: 2
3: 9
4: 224
935308821_935308826 27 Left 935308821 2:101762508-101762530 CCATTCAACCCTGAGTACAGAAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG 0: 1
1: 0
2: 2
3: 9
4: 224
935308822_935308826 19 Left 935308822 2:101762516-101762538 CCCTGAGTACAGAAGTACTTTTG 0: 1
1: 0
2: 0
3: 15
4: 180
Right 935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG 0: 1
1: 0
2: 2
3: 9
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935308826 Original CRISPR CAGCTCTTGTAGAGGTAAAA CGG Intronic
901002419 1:6155294-6155316 CAGCTCTGGTAGAGGTGGGACGG - Intronic
902970267 1:20043306-20043328 CAGTTTTTGGACAGGTAAAATGG + Intronic
905327352 1:37164734-37164756 CAGATCTTATAGAAATAAAAAGG - Intergenic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
907372119 1:54010405-54010427 CATCTCCTGTAGAGGTACAGAGG + Exonic
908120144 1:60978737-60978759 AAGCACTTCTAGAGGTAAGATGG + Intronic
909014864 1:70370481-70370503 CAGTTTTTGGACAGGTAAAATGG - Intronic
909788122 1:79641349-79641371 CAGTTTTTGGACAGGTAAAATGG + Intergenic
910496406 1:87833695-87833717 TATTTCTTGTACAGGTAAAAAGG - Intergenic
911562092 1:99418342-99418364 CAGCTCTGGTGGAGGTAGCAGGG - Intergenic
912813713 1:112812522-112812544 CAGTTTTTGGACAGGTAAAATGG - Intergenic
912911407 1:113762849-113762871 AAGCTCTTGTAGGGGGAAAAAGG - Exonic
913095629 1:115513180-115513202 CAGTTTTTGGACAGGTAAAATGG + Intergenic
916421155 1:164638970-164638992 CAACTCCTGTAGAGAAAAAACGG - Intronic
916941943 1:169685960-169685982 CAGTTTTTGGACAGGTAAAATGG - Intronic
917537750 1:175886842-175886864 CAGCTCATGGAGAGGAACAATGG + Intergenic
917558305 1:176115498-176115520 CAGCACTTGGAGAGGTCAAGGGG + Intronic
917673030 1:177292026-177292048 CAACTCTGGTACTGGTAAAATGG - Intergenic
918017825 1:180654037-180654059 CAGATCTTCCAGTGGTAAAATGG + Intronic
918960574 1:191271437-191271459 AAGATCTTGAAGAGGCAAAATGG + Intergenic
919476551 1:198037867-198037889 CAGTTTTTGGACAGGTAAAATGG - Intergenic
919520489 1:198582135-198582157 CTGCTCTGGTAGAGGTAACAGGG + Intergenic
922845267 1:228679600-228679622 CAGTTTTTGGACAGGTAAAATGG + Intergenic
922972453 1:229754255-229754277 GAGCTCTTGTAGAGAGAACATGG - Intergenic
1065836872 10:29666271-29666293 CAGCTTTGAGAGAGGTAAAAAGG + Intronic
1067982849 10:51106667-51106689 CAAGTCTTCCAGAGGTAAAAAGG - Intronic
1068173114 10:53421937-53421959 CTGCTCTGGTGGAGGTAAAAGGG + Intergenic
1068463030 10:57351531-57351553 CAGCTCATGTAGAGCCAAGAGGG - Intergenic
1070289721 10:75106248-75106270 CAGCTCTTGAAGTGTTAAAAAGG - Intronic
1071017459 10:81014760-81014782 CACCTTTTGTTGTGGTAAAAAGG - Intergenic
1071870910 10:89793503-89793525 CTGCTCTGGAAGATGTAAAAGGG + Intergenic
1073049520 10:100658500-100658522 AAGCTCTTGTGGAGGCAGAATGG - Intergenic
1074786736 10:116848760-116848782 CAGGACTTGGGGAGGTAAAACGG - Intergenic
1079627707 11:22635284-22635306 CAGCTCTAGTGGAGATCAAAGGG + Intronic
1080994339 11:37581343-37581365 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1081159848 11:39737489-39737511 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1081683432 11:45024876-45024898 GACCTCTTGTAGAGGTCAAGAGG - Intergenic
1084892473 11:72243460-72243482 CAGCGCTTGTAGAGGTTTAGTGG + Intronic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086979574 11:93178550-93178572 CAGCTTTTGTAAAAGGAAAAGGG + Intronic
1088527622 11:110773829-110773851 CAGCTCTTTGAGGAGTAAAATGG - Intergenic
1088763112 11:112950571-112950593 CAGTTCTTGCAGAGGTATCAAGG + Intergenic
1089837014 11:121379474-121379496 CTGCTCTGGTAGAGGTAGCAAGG - Intergenic
1093349761 12:18084012-18084034 CAGCCCTTTAGGAGGTAAAATGG + Intronic
1093836387 12:23834722-23834744 CAGTTCTTAAAGAGGTAAGAAGG + Intronic
1093882230 12:24417935-24417957 GAGCTCATTTAGAGGTATAAAGG + Intergenic
1094028013 12:25979615-25979637 CAGTTTTTGCAGAAGTAAAATGG - Intronic
1096453706 12:51767987-51768009 CACCATTTGTAGAGTTAAAAAGG - Intronic
1097572639 12:61354459-61354481 CAGTTCTTTGAGAGGGAAAATGG + Intergenic
1099491853 12:83298226-83298248 CAGCACTTTGGGAGGTAAAATGG - Intergenic
1101923740 12:108954254-108954276 CAGCTTTTGTACCTGTAAAATGG + Intronic
1102303204 12:111785971-111785993 CAGATCTTACAGAGATAAAAAGG - Intronic
1102554624 12:113718944-113718966 CAGCCCTGGGAAAGGTAAAATGG - Intergenic
1104913310 12:132250813-132250835 CAGCTCATGCCGAGGTAAGACGG + Intronic
1106285752 13:28317004-28317026 CAGGTCTTGGAGAGGAAAAGGGG - Intronic
1108825739 13:54409769-54409791 CAGTTCTTGTAGTGGTAACTTGG - Intergenic
1109508245 13:63335405-63335427 CAGCTCTTGTAGTGGTAGCTTGG + Intergenic
1110181856 13:72626445-72626467 CTGCTCTGGTAGAGGTAGCAAGG - Intergenic
1115880327 14:37910011-37910033 CAGCTCTAGTAGCCCTAAAAAGG - Intronic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1116703144 14:48264988-48265010 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1117445989 14:55804365-55804387 CAGCTCCTGTACAGGCACAATGG + Intergenic
1118251216 14:64163385-64163407 CAGCTCCTGCAGAAGAAAAAGGG - Exonic
1118937106 14:70298422-70298444 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1119631099 14:76232898-76232920 CAGCCCCTCCAGAGGTAAAATGG + Intronic
1122474606 14:101998302-101998324 CAGCTCTTATAGAGGGGAGAGGG - Intronic
1122696925 14:103559524-103559546 CAGCTTTTGTAGATTTTAAATGG - Intronic
1125849228 15:42887562-42887584 CAGTTTTTGGACAGGTAAAATGG - Intronic
1126503041 15:49368857-49368879 GAACTCTTATAGAGGAAAAAGGG - Intronic
1126577719 15:50212757-50212779 CAGGTCTTGTAGTGGTAACGTGG - Intronic
1129676680 15:77635423-77635445 CAGCTCATGCAGAGGTAACTGGG - Intronic
1138129544 16:54467994-54468016 CAGCTCTTGTAGAGGTGAACAGG + Intergenic
1141304727 16:82851509-82851531 CAGTTCTTGGGGAGGTAAAAGGG - Intronic
1141957409 16:87382410-87382432 CAGCTCATATTTAGGTAAAAAGG - Intronic
1144068436 17:11645335-11645357 AAGTTATTTTAGAGGTAAAAGGG - Intronic
1146578382 17:34014047-34014069 CAGCTCTAGGAGAGGAGAAAAGG - Intronic
1148590865 17:48816019-48816041 CAGCTTCTGTATAAGTAAAATGG + Intronic
1153052019 18:908546-908568 GAGCTCTGGAAGAGGCAAAAAGG + Intronic
1153451302 18:5232589-5232611 CTGCTCTGGTGGAGGTAAGAGGG + Intergenic
1153773314 18:8432714-8432736 GAGCTTTTGTAGCGGTAGAAAGG + Intergenic
1156426694 18:37021092-37021114 CAGCTCTAGTATAGTTAAAATGG - Intronic
1159027351 18:63196153-63196175 CAGGTCTGGTAGAGGTTACAGGG - Intronic
1161712265 19:5855508-5855530 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1163886542 19:19970627-19970649 CTGCTCTGGTAGAGGTAGCAGGG + Intergenic
1163887941 19:19984779-19984801 CTGCTCTGGTAGAGGTAGCAGGG - Intergenic
1163967957 19:20765512-20765534 CTGCTCTGGTAGAGGTAGCAGGG - Intronic
1164202367 19:23029478-23029500 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1164412967 19:28020987-28021009 CAGCTCTGGTGGAGGGAAGAGGG - Intergenic
1165249387 19:34517072-34517094 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1165496862 19:36158044-36158066 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1165966900 19:39589391-39589413 CAGCTCTTGTAGCAGGAAAAGGG - Intergenic
1165968998 19:39609423-39609445 CAGCTCTTATAGTGGGAAAAGGG - Intergenic
1165972592 19:39644940-39644962 CAGCTCTTATAGAGGGAAAAGGG - Intergenic
1165979809 19:39711024-39711046 CAGCTCTTACAGTGGGAAAAGGG - Intergenic
925583334 2:5436872-5436894 CAGCACTAGTAGAGGCAAAGTGG - Intergenic
925956924 2:8975696-8975718 CACTTCTTGTATAGGTACAATGG + Intronic
926968467 2:18442037-18442059 CAGTTCATGTAGAGGAATAACGG + Intergenic
926978704 2:18542714-18542736 CAGATGTTGAAGAGTTAAAACGG + Intergenic
927134301 2:20085390-20085412 CAGTTTTTGAACAGGTAAAATGG - Intergenic
929197103 2:39196273-39196295 CTGCTCTGGTAGAGGTAGCAGGG - Intronic
929684380 2:44021668-44021690 CAGTTTTTGAACAGGTAAAATGG + Intergenic
930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG + Intergenic
931446509 2:62331460-62331482 CAGGTATTGGAGAGGAAAAATGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934166579 2:89299496-89299518 TTGCTTTTGTAGAGGGAAAAGGG + Intergenic
934200698 2:89882960-89882982 TTGCTTTTGTAGAGGGAAAAGGG - Intergenic
935308826 2:101762558-101762580 CAGCTCTTGTAGAGGTAAAACGG + Intronic
935435818 2:103030852-103030874 CAGCTCTAGTAGAGGAGAACTGG + Intergenic
938215644 2:129510933-129510955 AGGCACTTGTAGAGGGAAAATGG + Intergenic
938421575 2:131151441-131151463 CAGCTCCTGCAGTGGTGAAAAGG - Intronic
939099339 2:137878051-137878073 CAGCTCTTGTAGAAATTAAGAGG + Intergenic
939979486 2:148761544-148761566 CAGCTGTTGAAAAGGTAGAATGG - Intronic
940183098 2:150956131-150956153 CAGTTTTTGGACAGGTAAAATGG - Intergenic
941655058 2:168134398-168134420 CAGCTCTGCTTGAGGTCAAAGGG - Intronic
942113118 2:172701801-172701823 AAGCATTTCTAGAGGTAAAAAGG - Intergenic
942425957 2:175861091-175861113 CATCTCTTCTAGAGGGAACATGG - Intergenic
944602166 2:201313816-201313838 CTGCTCTGGTAGAGGTAGCAGGG - Intronic
947145524 2:227060576-227060598 CTGCCCTTGTAGGGGTAAAGAGG + Intronic
947791126 2:232870090-232870112 CCGCTCTTGGAGAGGGAAAGAGG - Intronic
1169172206 20:3473863-3473885 GAGAGCTTGTAGAGGTGAAATGG + Intronic
1169604521 20:7301759-7301781 CAGCTTTGGTTAAGGTAAAAGGG - Intergenic
1173763631 20:45586821-45586843 CAGGTTTTGGACAGGTAAAATGG + Intergenic
1174667743 20:52275764-52275786 CAGATTTTGCAGATGTAAAATGG + Intergenic
1175567537 20:59992360-59992382 CATATCTTGTAGAAGGAAAACGG - Exonic
1178001338 21:28164293-28164315 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1180567654 22:16688630-16688652 CAGCTCTTCTAATGGGAAAATGG + Intergenic
1183635516 22:39060098-39060120 CAGTTTTTGCACAGGTAAAAGGG + Intronic
1185038750 22:48493528-48493550 GAGTTCTCGAAGAGGTAAAATGG + Intronic
1185201976 22:49512916-49512938 CGGATCTTGTAGAGAGAAAAAGG + Intronic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
949983404 3:9518717-9518739 CAGATCTTGTGGACATAAAAGGG - Intronic
952235496 3:31474916-31474938 CAGGTTTTCTACAGGTAAAAAGG + Intergenic
952791980 3:37207165-37207187 CAGTTTTTGGACAGGTAAAATGG - Intergenic
953382269 3:42480877-42480899 CTGCTCTTGTAGAGGTGGCAGGG - Intergenic
953510784 3:43536581-43536603 CAGCTCCTTTAATGGTAAAATGG + Intronic
953599291 3:44347650-44347672 CAGTTTTTGGACAGGTAAAATGG + Intronic
956002189 3:64741297-64741319 CAGCTCTTGTAGAGAATAGATGG + Intergenic
956963523 3:74431719-74431741 TAGTTCTTTTAGAGGGAAAATGG - Intronic
957609466 3:82448919-82448941 CAGCTCTAGTTGTGGTTAAAAGG + Intergenic
957795926 3:85007093-85007115 TATCTCTTTTGGAGGTAAAAAGG + Intronic
958183031 3:90084152-90084174 CAGTTTTTGGACAGGTAAAATGG - Intergenic
960718028 3:120596676-120596698 AAGCTCTGGCAAAGGTAAAAGGG - Intronic
961684746 3:128621996-128622018 CAGTCCTTGTGGAGGAAAAAGGG - Intronic
963058773 3:141208058-141208080 CCGGTTTTGGAGAGGTAAAATGG - Intergenic
963111695 3:141693917-141693939 CAGTTTTTGGACAGGTAAAATGG + Intergenic
963456518 3:145553806-145553828 CAGTTTTTGGACAGGTAAAATGG + Intergenic
964112190 3:153099208-153099230 CAGCTCAGGTAGAGTTACAAAGG + Intergenic
965716893 3:171614537-171614559 CAGTTATTGTAGAGTTAACAAGG - Intronic
965836343 3:172857259-172857281 GAGTTCTAGTAGAGATAAAAGGG - Intergenic
967955713 3:194875977-194875999 CAGCTCTTGTGCAGAGAAAATGG + Intergenic
968319720 3:197754911-197754933 CAGCACTTTTAGAGGTGAGATGG - Intronic
969206402 4:5650259-5650281 CAGCCCTGGAAGAGGCAAAAAGG + Intronic
971552799 4:27977056-27977078 CAGTTTTTGGACAGGTAAAATGG - Intergenic
973551532 4:52040061-52040083 CAAGGCTTGTAGAGGTTAAATGG + Intergenic
973920156 4:55675927-55675949 CTGCTCTGGTGGAGGTAACAGGG - Intergenic
974028915 4:56758182-56758204 CAGCTCTTAAAGAGCTAAACAGG - Intergenic
974500539 4:62695461-62695483 CAGGTCCTGTATATGTAAAATGG - Intergenic
974903924 4:68033702-68033724 CAGTTTTTGGACAGGTAAAATGG - Intergenic
975080620 4:70275557-70275579 CAACTCATCTAGAGGTAAATTGG + Intergenic
979185758 4:117790476-117790498 AAGCTCTGAAAGAGGTAAAATGG - Intergenic
980491211 4:133531819-133531841 CAGTTCTAGGACAGGTAAAATGG + Intergenic
980519252 4:133909815-133909837 CTGCTCTGGTAGAGGTAGCAGGG + Intergenic
980575481 4:134680534-134680556 CAGTTTTTGGACAGGTAAAATGG + Intergenic
980926762 4:139145298-139145320 CAGCTCTCATAGGGGTAACAGGG - Intronic
981184265 4:141782641-141782663 CAGCTCTGGTTGTGGTTAAAAGG - Intergenic
982281354 4:153685646-153685668 CAGTTTTTGTAAATGTAAAATGG - Intergenic
982829809 4:160044929-160044951 CTGCTCTGGTAGAGGTAGCAGGG - Intergenic
984973089 4:185208057-185208079 CAACTATTTTAGAGGCAAAAGGG + Intronic
987901957 5:24023720-24023742 CTGCTCTGGTAGAGGTAGTAGGG - Intronic
989688774 5:44117343-44117365 CAGTTTTTGGACAGGTAAAATGG + Intergenic
990896186 5:60702126-60702148 GAGCTCATTAAGAGGTAAAAGGG + Intergenic
994557956 5:101329031-101329053 CATATCATGTAGAGTTAAAAGGG - Intergenic
996960461 5:129242124-129242146 CAGCCCATGTAGAGAAAAAAAGG - Intergenic
997845678 5:137283743-137283765 AAACTAGTGTAGAGGTAAAAGGG + Intronic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
999468196 5:151826953-151826975 CAGCTAGTGTATAGGGAAAATGG + Intronic
1001265251 5:170269397-170269419 CAGCTCTTCCACAGGGAAAAGGG + Intronic
1001331303 5:170764667-170764689 CAGTTTTTGGACAGGTAAAATGG + Intronic
1002610804 5:180417348-180417370 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1003801706 6:9677338-9677360 CATTTCTTGTAAAGCTAAAAAGG + Intronic
1004358398 6:14949715-14949737 GAGCTCATGTAGAAGAAAAATGG + Intergenic
1007821683 6:44565061-44565083 CATCTCTTGGTGATGTAAAATGG - Intergenic
1007997848 6:46327525-46327547 CAGCTTTTGAAAAGGTAAATGGG + Intronic
1008231267 6:48987071-48987093 CTACTCTGGTAGAGGTAGAAGGG - Intergenic
1009464472 6:63952966-63952988 CAGTTTTTGGACAGGTAAAATGG - Intronic
1010033622 6:71295485-71295507 AAGTTCTTGTAGAGGAAAAGTGG + Intronic
1012416060 6:99015232-99015254 TTGCTCTGGTGGAGGTAAAAAGG - Intergenic
1013802508 6:113963972-113963994 CAGATTTTGTAGAGATAATATGG + Intronic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1022373022 7:29787927-29787949 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1022434869 7:30373485-30373507 AAGGTGTTGTAGAGGTACAAAGG + Intronic
1024854234 7:53758682-53758704 CATTCCTTGTAGAGGTAAAGTGG + Intergenic
1029547885 7:101220550-101220572 CAGCTGTTGTAAGGGTTAAATGG + Intronic
1030909015 7:115223595-115223617 CAATTCTTATAGATGTAAAATGG - Intergenic
1031573864 7:123392416-123392438 CAGCTCTGATAGAAGTAACAAGG + Intergenic
1039120834 8:34144516-34144538 GAGCTCTTTTAGAAGAAAAATGG + Intergenic
1041043850 8:53873201-53873223 CAGCTTTTGGAGAGGTCTAAGGG - Intronic
1042488534 8:69373486-69373508 CAGTTCTGGTAGAGACAAAAGGG - Intergenic
1043598983 8:81916519-81916541 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1045425797 8:102064571-102064593 CATCACTTGTAGAAGTAGAAGGG - Intronic
1045798872 8:106078644-106078666 CAGCACTTTTAGAGGCAAGATGG - Intergenic
1046478396 8:114780258-114780280 GAGCTCTGATAGAGGTACAAGGG + Intergenic
1047067601 8:121303124-121303146 CACCTCTTGAAGAACTAAAAGGG - Intergenic
1047816166 8:128465423-128465445 CAGGTATAGTAGAGATAAAAGGG + Intergenic
1047937450 8:129796777-129796799 CTGCTCTGGTGGAGGTAACAGGG + Intergenic
1053059781 9:35021969-35021991 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1053308282 9:36999466-36999488 CAGATCTTGCAGAGGTGAACGGG - Intronic
1056977359 9:91270594-91270616 CACCCCTTGTAGAGCAAAAAGGG + Intronic
1058184717 9:101840891-101840913 CAGATTTTGTAGAATTAAAAGGG + Intergenic
1059319285 9:113455397-113455419 CAGCTCTTGAAGAGGCTGAAAGG + Intronic
1185568148 X:1112409-1112431 CAGCTCTTGCATAGTTCAAATGG - Intergenic
1185950870 X:4432379-4432401 CCGCTCTGGCAGAGCTAAAATGG + Intergenic
1186330835 X:8531577-8531599 CAGCTCTTTTAAAGGTCATAAGG - Exonic
1187103621 X:16219450-16219472 CAGTTTTTGGACAGGTAAAATGG + Intergenic
1187303347 X:18073031-18073053 CAGACTTTGTAGAGGAAAAAGGG + Intergenic
1189048860 X:37622123-37622145 CAATTCTTATAGTGGTAAAAAGG + Intronic
1189469736 X:41304404-41304426 CTGCTCTTGGAGTGGTCAAAGGG + Intergenic
1192178246 X:68899176-68899198 CGGCTCTTGAAGAAGTAAGAAGG + Intergenic
1193537217 X:82729913-82729935 CGGCTTTTGGACAGGTAAAATGG - Intergenic
1193771743 X:85595414-85595436 CAGCTCTTGTAGTGCTAACTTGG - Intergenic
1193880775 X:86918385-86918407 CTGCTCATGAAGAGGTAAATAGG - Intergenic
1193886069 X:86984886-86984908 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1194191918 X:90848120-90848142 CTGCTCTGGTAGAGGTGACAGGG + Intergenic
1194367247 X:93026019-93026041 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1194615818 X:96102614-96102636 CTGCTGTTGGAGATGTAAAATGG + Intergenic
1195149745 X:102054457-102054479 CAGCTATTGTAGTGTTAAGAGGG + Intergenic
1195677513 X:107518317-107518339 GAGCCCTTGTGGAGGTAAACTGG + Intergenic
1197463460 X:126771932-126771954 CTGCTCTGGTAGAGGTGACAGGG - Intergenic
1200538556 Y:4430555-4430577 CTGCTCTGGTAGAGGTGACAGGG + Intergenic
1200675461 Y:6142276-6142298 CAGTTTTTGGACAGGTAAAATGG - Intergenic
1201432405 Y:13917221-13917243 CAGCTCTTTTAAAGGTTATAAGG + Intergenic
1202076389 Y:21041709-21041731 CAGTTTTTGGACAGGTAAAACGG + Intergenic
1202251625 Y:22879167-22879189 CAGCTCTCCTACAGGTAAACAGG - Intergenic
1202404613 Y:24512916-24512938 CAGCTCTCCTACAGGTAAACAGG - Intergenic
1202466166 Y:25157166-25157188 CAGCTCTCCTACAGGTAAACAGG + Intergenic