ID: 935309053

View in Genome Browser
Species Human (GRCh38)
Location 2:101765030-101765052
Sequence CAAGGTAAACTTGAGGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935309050_935309053 7 Left 935309050 2:101765000-101765022 CCAAAAAATGTTAATCAGAATTT 0: 1
1: 0
2: 5
3: 84
4: 749
Right 935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG 0: 1
1: 0
2: 1
3: 13
4: 218
935309049_935309053 22 Left 935309049 2:101764985-101765007 CCATTATCAGATGGTCCAAAAAA 0: 1
1: 0
2: 1
3: 18
4: 371
Right 935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG 0: 1
1: 0
2: 1
3: 13
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935309053 Original CRISPR CAAGGTAAACTTGAGGATAA AGG Intronic
903443602 1:23406545-23406567 CAAGGAAAGATTGTGGATAAAGG - Intronic
904459124 1:30664983-30665005 CAAGGTCATCTTGGGGAGAAGGG + Intergenic
904796847 1:33062607-33062629 CAGGGTAGATTGGAGGATAAGGG + Intronic
904862249 1:33547343-33547365 CATGGTAAACATGAGGAAAGAGG + Intronic
907895226 1:58682469-58682491 CAAGTTAAAAATGAAGATAAAGG - Exonic
909815601 1:79988967-79988989 CAAAGTACACTTGAGAATGATGG - Intergenic
910650831 1:89565262-89565284 TAAGGTTAACTTGTGGAAAAGGG + Intronic
911589699 1:99732573-99732595 CAAGGTAAAGATGAGATTAAAGG + Intronic
914865186 1:151421366-151421388 GAAAGAAAAATTGAGGATAAGGG + Intronic
915760927 1:158311947-158311969 CAAAGTAATCTTGAGCAAAAAGG - Intergenic
915796344 1:158738384-158738406 CAAGGTGAACTTTAGAATGAGGG - Intergenic
916191436 1:162182400-162182422 CAAGGTACACTTGATGTTGATGG + Intronic
919575933 1:199309825-199309847 CAAGGAAAACTTGAGCTGAAAGG - Intergenic
920552145 1:206871157-206871179 CAAAGTAGACTGGAGGTTAAGGG + Intergenic
921468849 1:215524583-215524605 AAAGTAAAAGTTGAGGATAAGGG - Intergenic
924088091 1:240474822-240474844 CAAGTTATAGTTGTGGATAAAGG + Exonic
924669055 1:246104718-246104740 GAAGGTAAACATGAGGAAATTGG - Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1063757177 10:9026014-9026036 CAAGTTAAAATTTTGGATAAAGG - Intergenic
1064407008 10:15072905-15072927 TAAGGTAAACTTTAGAATGAGGG + Intronic
1066977676 10:42384505-42384527 CAAGGTGAACTTTAGAATGAGGG + Intergenic
1066978968 10:42393459-42393481 CAAGGTGAACTTTAGAATGAGGG + Intergenic
1070540514 10:77412248-77412270 CCAGGAAAATTTGAGGACAAAGG - Intronic
1071542456 10:86499300-86499322 CAAGCTAAACTTGAGTATCTAGG + Intronic
1073695818 10:105866097-105866119 CCAGGTAAACATGAGAAGAATGG - Intergenic
1075722573 10:124596006-124596028 GACGGTAAACTTGAGGTGAATGG + Intronic
1076552632 10:131293370-131293392 CAAGGTGAACTTTAGCATGATGG - Intronic
1080493301 11:32791472-32791494 CAAGGTAAACTTGGGAAATACGG - Intronic
1083122655 11:60531085-60531107 CAAGGTAAACTTCTGCGTAACGG - Intronic
1083356284 11:62068725-62068747 CAAGGAAATATTTAGGATAAGGG + Intergenic
1084733321 11:71088706-71088728 CAAGGTCAAGTTCAGGATGAGGG - Intronic
1084733337 11:71088760-71088782 CAAGGTCAAGTTCAGGATGAGGG - Intronic
1084733396 11:71088976-71088998 CAAGGTCAAGTTCAGGATGAGGG - Intronic
1086104983 11:83137922-83137944 CAAGGGAAACTTGAAGAATAGGG - Intergenic
1086731881 11:90260352-90260374 CAAAGTAAACAAGAGCATAAAGG - Intergenic
1087324831 11:96708911-96708933 AAAGGTGAACTTGAGGATTGTGG + Intergenic
1089547112 11:119236880-119236902 GAAGGTTAAACTGAGGATAAAGG - Intronic
1089838603 11:121393898-121393920 AAAGGGAAACTTGAACATAAAGG - Intergenic
1090158487 11:124466357-124466379 CAAGGCACAGTTGAGGGTAAAGG - Intergenic
1091883458 12:3998621-3998643 CAAGGTGAACCTGAGGCTCAGGG - Intergenic
1093983701 12:25503481-25503503 CAAGGATAAATTGAGGATATGGG + Intronic
1095855478 12:46855581-46855603 CAAGATAAACTTGGGGATCCTGG + Intergenic
1095869193 12:47007256-47007278 CGAGGTCAACTTCAGGACAAGGG + Intergenic
1097086490 12:56472186-56472208 CAAGGCAAACCTGAGGGTAGTGG + Exonic
1098150485 12:67541415-67541437 CAAGGTAAATGTGAGGTTATTGG - Intergenic
1098937760 12:76499891-76499913 TAAGGGAAACTTGAGCATTATGG - Intronic
1103612196 12:122130626-122130648 GAAGGTAAAATTGAGTATCAGGG - Intronic
1104166095 12:126231020-126231042 GAAGTTCAACTTGAGGGTAAGGG + Intergenic
1104795614 12:131514964-131514986 CAAGGCCAACCTGAGGTTAAGGG + Intergenic
1105361933 13:19726897-19726919 CATAATAAACTTGAGAATAAAGG - Intronic
1105682476 13:22743582-22743604 CATAGTAAAGTTGAGGATATCGG + Intergenic
1106014795 13:25858493-25858515 CCAGGTAAATCTGTGGATAAGGG - Intronic
1108151351 13:47538359-47538381 CCATGTAAACTTGAGAAGAATGG - Intergenic
1109261382 13:60149071-60149093 CAAGGGAAAGTTGAGGAAAGGGG + Intronic
1109848343 13:68027217-68027239 TAAGCTAACCTTGAGGTTAACGG + Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1111445401 13:88340673-88340695 GAAGGTAAATTTGAGGATAAAGG + Intergenic
1112041336 13:95551793-95551815 CAAGGTAAACATAAAGATCAAGG - Intronic
1112131515 13:96529636-96529658 ATAGGCAAACTTGAGAATAATGG - Intronic
1113529204 13:111007922-111007944 CACGCTAAACTTGAGGCTAAGGG - Intergenic
1113722431 13:112569736-112569758 CACCATAAAATTGAGGATAAAGG + Intronic
1115461771 14:33669032-33669054 CATGTAAAATTTGAGGATAATGG + Intronic
1115665470 14:35540257-35540279 CAAGATAAATTTGTGGATGAGGG + Intronic
1116035122 14:39618327-39618349 CTAGGAAATGTTGAGGATAAAGG - Intergenic
1116437313 14:44909972-44909994 CAAATTAAATTTGAGGTTAAAGG - Intergenic
1117187506 14:53255615-53255637 CAAGGTAAACTTGGGGCTCTTGG + Intergenic
1117442070 14:55769431-55769453 CAATGGAAACTAGAAGATAAAGG - Intergenic
1117452952 14:55869325-55869347 CAAGGTCACCTTAATGATAATGG + Intergenic
1118631467 14:67707803-67707825 CAAGGTAAACTTGGGGCTCCTGG + Intronic
1120613398 14:86671280-86671302 CAAGGTAAACCTCAGGAAACTGG - Intergenic
1120778853 14:88467408-88467430 TAATGTAAAGTTGAGGATGAAGG - Exonic
1121730524 14:96183815-96183837 CAAGGTGACCTGGAGAATAATGG + Intergenic
1124506272 15:30277279-30277301 CAAGGTATATTTCAGGACAAGGG + Intergenic
1124737284 15:32261357-32261379 CAAGGTATATTTCAGGACAAGGG - Intergenic
1125793150 15:42385193-42385215 CAATTTAAATTTGAGGAAAAGGG + Intronic
1126267387 15:46770396-46770418 CATGGTAAATTTGGGGATTAAGG - Intergenic
1126841172 15:52718726-52718748 AAAGGTCATCTTGAAGATAAGGG - Intergenic
1127031443 15:54868736-54868758 CAAAGCAATCTTGAGGAAAAAGG + Intergenic
1127680655 15:61294109-61294131 CAAGGTAATCTGGAAGAAAATGG + Intergenic
1129945137 15:79533179-79533201 CAAGATACACTAGAGCATAAAGG - Intergenic
1131284201 15:91043907-91043929 CCAGATAGACTTGAGGAGAATGG - Intergenic
1131338590 15:91573820-91573842 TCAGGTAAAGTTGAGGATATTGG + Intergenic
1131809501 15:96158172-96158194 CAAGGAAAGCTGGAGGAGAAAGG + Intergenic
1132240728 15:100255386-100255408 CAAGGTAACCTTCAGGGAAATGG + Intronic
1135910047 16:26552017-26552039 CCAGGGAAACTTGTGTATAAGGG + Intergenic
1136637105 16:31531346-31531368 CTAGGTCAAGTTGAGGATCAAGG - Intergenic
1137933587 16:52611764-52611786 CAAGGTAAGCTTGAGTATTCTGG + Intergenic
1138980968 16:62267789-62267811 CAAGGCAATCTTGAGCAAAAAGG + Intergenic
1140273308 16:73485400-73485422 CAAGGTAAATTTGAGGGTGAGGG + Intergenic
1148532917 17:48412054-48412076 TAAGGGAAACTGGAGGAGAAAGG + Intronic
1153058011 18:967039-967061 CAACAGAAACTTGAGGATAAAGG - Intergenic
1153532202 18:6058583-6058605 CAAGGTATATTTGAAGGTAAAGG + Intronic
1155846515 18:30714590-30714612 CAAGATAGACTGGAGGCTAAAGG - Intergenic
1156979498 18:43267668-43267690 GAAGCAAAACTTGAGGATCAAGG - Intergenic
1157212317 18:45754178-45754200 AAAGGGAAACTTGTGGATAAAGG + Intergenic
1157784388 18:50469018-50469040 CAATTTAAACTAGAGGATCATGG - Intergenic
1159425017 18:68273681-68273703 CAAAGAAAACATGAGGATTATGG + Intergenic
1159596488 18:70387528-70387550 CCAGGTAAGCTTGTGTATAATGG + Intergenic
1160118994 18:76110187-76110209 CAGGGTAAAATTCAGGTTAATGG - Intergenic
929072996 2:38052755-38052777 AAAAGTAAGTTTGAGGATAATGG - Intronic
929535521 2:42781414-42781436 CAAGGTAAACTTGAGGCCTTTGG - Intronic
932444562 2:71768207-71768229 CAAGGCAAACCTGAGGAGATAGG - Intergenic
932894495 2:75626005-75626027 CAGGGTAAACCTGAAGATATTGG - Intergenic
934962192 2:98686038-98686060 CAAGTTAATCTTCAGGATTACGG - Intronic
935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG + Intronic
935928915 2:108101854-108101876 TAAGGTAAACTTTAGAATGATGG + Intergenic
936454065 2:112657351-112657373 AAAGGGAAATTTGAGGATATGGG + Intronic
936659523 2:114527045-114527067 CAAAGTAAAATTAAGGAAAAGGG - Intronic
937579921 2:123472765-123472787 CAAGATAAACTTGGGGATTCTGG - Intergenic
938815507 2:134900148-134900170 GAAGGCAAAACTGAGGATAAGGG - Intronic
940016161 2:149107461-149107483 GAAAGTGAACCTGAGGATAAGGG + Intronic
942506118 2:176643396-176643418 CAAGGCAAATTTGAAGAAAATGG - Intergenic
943193384 2:184710262-184710284 CAAGGTATATTTGAGGGTGATGG - Intronic
943976347 2:194483686-194483708 CATGGTTGACTTGAGGAAAAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945561970 2:211350582-211350604 CAAGGTAAAATACAGAATAAAGG - Intergenic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
947287848 2:228537436-228537458 CAAGATAAACTTGAGGCTCCTGG - Intergenic
1169449128 20:5696400-5696422 CAAGGGAAACATGAGGACAGTGG + Intergenic
1169656194 20:7926390-7926412 TTAGGTAAAATTGAGAATAATGG + Intronic
1169791046 20:9411057-9411079 CAGGGAAAATTTGAGTATAATGG + Exonic
1170050693 20:12141587-12141609 CAAGGAAGACTTGAGGCTTAGGG + Intergenic
1172295444 20:33807323-33807345 GCAGGTACACCTGAGGATAAAGG - Intergenic
1172822887 20:37754044-37754066 CAATGCAAGCTTGAGGACAAGGG - Intronic
1173111286 20:40192896-40192918 CAAGGGCAAATTGAGGAAAAGGG - Intergenic
1173932388 20:46831696-46831718 CATAGTAAACTTGAGGACAATGG - Intergenic
1175253490 20:57623899-57623921 TAAGGCAAACTTGAGAATGAAGG - Intergenic
1175763247 20:61575282-61575304 CAAGTTTAAGTTGAGGAGAAAGG + Intronic
1177766835 21:25468049-25468071 CAAGGGAAACTTGAAGGTAAGGG - Intergenic
1181676014 22:24453091-24453113 AAAGGTAAAATTGAAGACAAAGG + Intergenic
1181864070 22:25841374-25841396 AAAAGTCAACTTCAGGATAAAGG + Intronic
1181906921 22:26205425-26205447 TAAGGTAAACCTGAGGAAGAAGG - Intronic
951746467 3:25983175-25983197 CAAGCTAAACCTGATGTTAAGGG + Intergenic
952051091 3:29385397-29385419 TCAGGAAAATTTGAGGATAAAGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
959149264 3:102589249-102589271 TAAGGTTAATTTGAGGATATGGG + Intergenic
959417492 3:106094017-106094039 GAAGGTAAATTTCAGGATCATGG + Intergenic
959846585 3:111040459-111040481 CAAGGTAAACTTCAGGCCATGGG + Intergenic
960779192 3:121299310-121299332 CATAGAAACCTTGAGGATAAAGG + Intronic
963515989 3:146308677-146308699 CAAGGTAAAATAGAGGACATGGG - Intergenic
965287092 3:166830036-166830058 TAAGATAAACTTGAGGGTCAAGG - Intergenic
966233346 3:177673022-177673044 CAAGACAAGCTTGAGAATAATGG - Intergenic
966297448 3:178440629-178440651 CCAGGGAAACTGGAGGGTAAGGG + Intronic
966595499 3:181721663-181721685 CAAAATAAACTTGAGCATATGGG + Intergenic
969348070 4:6581614-6581636 CAAGGTGAGATGGAGGATAAAGG - Intronic
969985968 4:11211418-11211440 CAAGGTCATCCTGCGGATAAGGG + Intergenic
970372783 4:15424683-15424705 CAAGGTAGAGTTGTGGAGAAGGG - Intronic
971634124 4:29034443-29034465 CAAGATGAACTTTAGAATAATGG + Intergenic
973922539 4:55703108-55703130 CAAGTCTAACTTGAGGATCATGG - Intergenic
974633656 4:64529821-64529843 CAAGGCATACTTGAGGTTAGAGG + Intergenic
976000460 4:80368338-80368360 CCAGATATACTTGAGAATAAAGG - Intronic
976266784 4:83192640-83192662 CAATGTCAACTGGAGAATAATGG + Intergenic
976632996 4:87258690-87258712 CAAGGAAAATTTGAGAATTAAGG + Intergenic
976658310 4:87512309-87512331 TAAGGAAAAATTGAAGATAAAGG + Intronic
978856968 4:113404401-113404423 CCAGGTAAACATGAGGAAGATGG + Intergenic
979704700 4:123708470-123708492 AAAGGTAAACTTGAGGAGTTAGG + Intergenic
981611724 4:146600286-146600308 CAAGGTTAACTTCAGGACATTGG + Intergenic
983194994 4:164797312-164797334 GAAGGTAAACTTGGGGATATGGG + Intergenic
983197233 4:164820788-164820810 CCAGGTAGACTTGGGGATAAAGG - Intergenic
983674880 4:170280794-170280816 TAAGGTAAACTTTAGAATGAGGG - Intergenic
984023573 4:174516472-174516494 CAAGGTCTACTTGAGGATGAAGG + Intronic
984800909 4:183716359-183716381 TAAGGAAAACTTGAATATAATGG - Intergenic
985197626 4:187449163-187449185 CAGGGCCAACTTGAGGTTAATGG - Intergenic
986019492 5:3787890-3787912 CAAGGTCAACTGGAGGAGAAAGG + Intergenic
986584083 5:9296601-9296623 CAAATTAAGCTTGAGCATAAAGG - Intronic
987248675 5:16076995-16077017 CAATGTACCCTTTAGGATAAAGG - Intronic
988976771 5:36523858-36523880 CAAGGGAAACATGAAGATGAAGG - Intergenic
989043938 5:37256173-37256195 GAAGTTAAACTTGATGAAAACGG - Intergenic
990493452 5:56323425-56323447 AAAGGTAAACTTAAGCATTATGG + Intergenic
992088843 5:73300371-73300393 CAGGGTAAATTATAGGATAATGG - Intergenic
993548902 5:89249281-89249303 CAAAGTAAACTTGAAGACAGGGG + Intergenic
994162720 5:96574614-96574636 CAAGGAAAATTTGAGAATTAGGG - Intronic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
1000776231 5:165423838-165423860 CAAGGTAAGCCTGAGAATAATGG - Intergenic
1005827707 6:29644925-29644947 CAAGGTAAGCTGGTGGTTAATGG + Intergenic
1008544032 6:52570139-52570161 CAATGTTAACTTGATGATAAGGG + Intronic
1010622247 6:78090664-78090686 TAAGGTAAACTTTAGAATGAGGG + Intergenic
1011025232 6:82861465-82861487 CATGGTATACCTGATGATAAGGG + Intergenic
1012313505 6:97757013-97757035 AAAGGTGAAAGTGAGGATAAAGG - Intergenic
1014104879 6:117550337-117550359 AAACCTAAACTAGAGGATAAGGG + Intronic
1014406211 6:121054441-121054463 CAAAGTAGACTTGAGAACAAAGG + Intergenic
1015376314 6:132513952-132513974 AAAGGTAAACTAGAGAATGAAGG + Intergenic
1018179832 6:161213096-161213118 CAAGATAAACTTGAGGCTCCTGG - Intronic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1018221849 6:161588944-161588966 CCAGATAAACTAGAGGATACCGG - Intronic
1019043030 6:169121739-169121761 AAAGTTTAACCTGAGGATAAAGG - Intergenic
1019233545 6:170588722-170588744 CAAGATAAACTTGAGGCTCCTGG + Intergenic
1021336334 7:19407202-19407224 AAAGCTAAACTTGATGATACAGG - Intergenic
1022646442 7:32233548-32233570 CAAAGTCAACTTCAGAATAAAGG + Intronic
1023300283 7:38762920-38762942 CAGGGTAACTTTGACGATAAAGG + Intronic
1024876866 7:54036278-54036300 CAAGGTGAACTTTAGAATAGTGG - Intergenic
1026337009 7:69403069-69403091 CAATGTAAACATGATGAGAATGG + Intergenic
1027605630 7:80294964-80294986 CCAGAGAAACTTTAGGATAATGG + Intergenic
1028042440 7:86071461-86071483 CAAAGTAAATTTTAAGATAAGGG - Intergenic
1028438802 7:90835088-90835110 CAAAGTAAACAAGAAGATAAAGG + Intronic
1030564047 7:111129330-111129352 CGTGGGAAACTTGAGGAAAAAGG - Intronic
1030779705 7:113585004-113585026 GAAGGTAAACTTCAGGGTTATGG + Intergenic
1032796381 7:135279726-135279748 AAAGCTAAACTTCAGGAAAAAGG - Intergenic
1033552834 7:142463211-142463233 CAAGGTAAAGTGGAGGACATGGG - Intergenic
1033557330 7:142500165-142500187 CAAGGTAAAGTGGAGGACACAGG - Intergenic
1033559764 7:142520186-142520208 CAAGGTAAAGTGGAGGACACAGG - Intergenic
1036776844 8:11618756-11618778 CAAGGTAAGCTGGAAGACAACGG - Intergenic
1037120914 8:15286105-15286127 CAAGATAAACTTTAAGGTAAAGG + Intergenic
1037631501 8:20660797-20660819 TAAGGCAAACTTTAGGATGAGGG + Intergenic
1042003289 8:64151276-64151298 CAAGAAGAACTTGAGTATAAAGG + Intergenic
1042506749 8:69568782-69568804 CAACATAAAGTTCAGGATAATGG + Intronic
1042884133 8:73529119-73529141 CAAGTTAACCTTGGGGAAAAAGG + Intronic
1045681901 8:104669935-104669957 AAATGTAAAATTTAGGATAATGG + Intronic
1046732191 8:117737737-117737759 CAAGGAAAACGTGAGGAGAAAGG - Intergenic
1048598144 8:135888643-135888665 CATGGTAAATCTGAGGCTAATGG + Intergenic
1050241815 9:3644494-3644516 CAAGGCAACCTTGGGGATAGAGG - Intergenic
1052586656 9:30437986-30438008 CAAGGCCTACTTGAGGATAGAGG + Intergenic
1052892876 9:33720128-33720150 CAAGGCCACCTTGAGGATATAGG - Intergenic
1055190221 9:73511037-73511059 CAAGGCCTACTTGAGGATGAAGG - Intergenic
1058555079 9:106158680-106158702 CAAGGTAAACATGTGGAACAGGG - Intergenic
1060235493 9:121859836-121859858 CAAGGAAGACTTCAGGAGAAGGG - Intronic
1061633784 9:131892045-131892067 CAGGCTAAACTTGAGGAACACGG + Intronic
1185891689 X:3827820-3827842 AAAGGTCAACTTAAGGATGATGG + Intronic
1185896798 X:3866234-3866256 AAAGGTCAACTTAAGGATGATGG + Intergenic
1185901916 X:3904661-3904683 AAAGGTCAACTTAAGGATGATGG + Intergenic
1187061144 X:15788507-15788529 CAAGGTCAACTTGGGGGTGAAGG + Intergenic
1187118053 X:16373687-16373709 CAAGGTGAACTTTAGAATGAGGG + Intergenic
1190851707 X:54250707-54250729 CAAACTAAATTTCAGGATAATGG + Intronic
1191046289 X:56141165-56141187 CAAGGGCAACTTGAGCAAAATGG - Intergenic
1193479225 X:82006864-82006886 CGGGGTATACTTGAGGATGAAGG - Intergenic
1197121951 X:122904645-122904667 CAAAGTAATATTGAGAATAAAGG + Intergenic
1197372698 X:125644476-125644498 CAAGGCCTACTTGAGGATAGAGG - Intergenic
1199043574 X:143142058-143142080 CAAGATAAACTTGAGGGTCCTGG + Intergenic
1199151135 X:144488448-144488470 CATGGCAAAGTGGAGGATAAAGG - Intergenic
1201630363 Y:16064560-16064582 CAAGGTGAACTTTAGAATGATGG + Intergenic
1201630757 Y:16070144-16070166 CAAGGTAAACTTTAGAATGGTGG - Intergenic
1202060419 Y:20881680-20881702 CATGGTAAATTTCAGGTTAAGGG - Intergenic