ID: 935315271

View in Genome Browser
Species Human (GRCh38)
Location 2:101827273-101827295
Sequence GCCTACATGTCATCTAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315268_935315271 10 Left 935315268 2:101827240-101827262 CCTCACTGGGCATCTGAAACACA 0: 1
1: 0
2: 1
3: 23
4: 217
Right 935315271 2:101827273-101827295 GCCTACATGTCATCTAGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315271 Original CRISPR GCCTACATGTCATCTAGAAT GGG Intronic
901169725 1:7247824-7247846 GCCTACCTGCCATTTAGAAATGG + Intronic
910023489 1:82621769-82621791 GCCTACATTTCTTCCAGAGTTGG + Intergenic
918498272 1:185163888-185163910 TTCTAAATGGCATCTAGAATGGG + Intronic
918510902 1:185313401-185313423 ACTTAAATGTCATCTAGATTTGG - Intronic
1069022759 10:63506986-63507008 GACTGCATGACATCTAGAAAAGG - Intergenic
1079166984 11:18053431-18053453 GCCTACATGACATCTTCATTTGG - Intergenic
1084856425 11:71990694-71990716 GACTACATGGCATCTACCATAGG + Exonic
1096695647 12:53346449-53346471 GCCTGAGTGCCATCTAGAATTGG - Intergenic
1114855323 14:26432383-26432405 GCCAACATTTAAGCTAGAATGGG - Intergenic
1123439995 15:20283407-20283429 GCCTACATGTCTTCTTGGACTGG + Intergenic
1124546771 15:30635961-30635983 GCATCCTTCTCATCTAGAATAGG - Intronic
1124780376 15:32625961-32625983 GCATCCTTCTCATCTAGAATAGG - Intronic
1125397510 15:39265548-39265570 GCCTACTAGTCATGTACAATAGG + Intergenic
1143630564 17:8137424-8137446 GCCCACATATCATCTACACTTGG - Intergenic
1149163394 17:53722050-53722072 GTCTACATTTCAGTTAGAATTGG + Intergenic
1150996162 17:70319976-70319998 TAATACATCTCATCTAGAATGGG - Intergenic
1152220245 17:79060274-79060296 TTCTTAATGTCATCTAGAATGGG - Intergenic
925863548 2:8203268-8203290 GCCCACCTGTCACCTAGGATAGG - Intergenic
930616408 2:53598878-53598900 GCCAACATGTCAGCTAGCAGTGG - Intronic
931471577 2:62543523-62543545 GCCCACATGTTATTTAGAAGAGG - Intergenic
931941645 2:67258215-67258237 CACTACATGACATTTAGAATTGG - Intergenic
933334013 2:80930909-80930931 ACCTAAATGTCATGTTGAATTGG - Intergenic
934084466 2:88498466-88498488 GCCTACAGGACATGAAGAATTGG + Intergenic
935315271 2:101827273-101827295 GCCTACATGTCATCTAGAATGGG + Intronic
940497998 2:154458296-154458318 GCCTACTTGACATCTACACTTGG + Intergenic
941615151 2:167710505-167710527 GCCTGCCTTTCATTTAGAATTGG + Intergenic
942634237 2:177985254-177985276 GTCTACATGTCAAATAGAGTTGG + Intronic
947917520 2:233843401-233843423 GCCTAAAAGTCACCAAGAATGGG + Intronic
1168897239 20:1332044-1332066 GTCTCCATGCCATCTGGAATGGG + Intronic
1172482549 20:35279478-35279500 GAAAAGATGTCATCTAGAATGGG - Intronic
1174920002 20:54691653-54691675 GCCTACATGTCACCTTGAAGAGG - Intergenic
1182636514 22:31731715-31731737 GCCTATATGTGTTCTAGGATTGG - Intronic
950779712 3:15380846-15380868 CCCTACCAGTCATCTAGACTGGG + Intergenic
950840744 3:15966143-15966165 GACTTCATTTCATCTAAAATGGG - Intergenic
951244900 3:20329883-20329905 ACCTACATTTCACCTAGAGTAGG + Intergenic
955961042 3:64341650-64341672 GTCTAGGTGGCATCTAGAATAGG + Intronic
958518926 3:95158824-95158846 GTCAACATGTCATCTACATTAGG + Intergenic
961058785 3:123811014-123811036 CCCTAAATCTCTTCTAGAATGGG + Intronic
962968613 3:140378281-140378303 TACTACATGTCATCCAGAGTAGG - Intronic
963411194 3:144930420-144930442 CCCTACATCTCATGTAGATTTGG - Intergenic
965665485 3:171089288-171089310 TCCTAAATGTCATTTAGAAAAGG - Intronic
977445297 4:97124035-97124057 GCATACACGTCATCAAGGATGGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
982687932 4:158514349-158514371 TCCTACATGACATCTAGATGTGG - Intronic
983160888 4:164413025-164413047 GCCTACCTCTCATTTAGAACTGG - Intergenic
984046152 4:174801418-174801440 GCCTACTTGTCATCTCCACTTGG + Intronic
984333219 4:178354101-178354123 GCCTACATGCCTTCCTGAATTGG + Intergenic
984609744 4:181824577-181824599 CCCTTCATGTCATATAAAATGGG - Intergenic
985843037 5:2323723-2323745 GCCCAAATCTCATGTAGAATTGG - Intergenic
986247595 5:6024878-6024900 GACTCCATGTCAGCTAGAAGTGG - Intergenic
992310196 5:75490237-75490259 GCCAACCTGTCATCTACACTAGG - Intronic
992982723 5:82193230-82193252 TCCTACAGTTCATCTAGAATTGG + Intronic
993028242 5:82671414-82671436 GCTTACCTGTCTTCTAGAGTGGG - Intergenic
993852875 5:93033245-93033267 GCCTACCTGTCATCTAGGTTAGG - Intergenic
1000075558 5:157782051-157782073 CCATACTTGTCATATAGAATAGG - Intergenic
1007266178 6:40597883-40597905 GCCTACTTGTCATCTGTCATTGG + Intergenic
1011726554 6:90215694-90215716 GCCTAAATGACAGCTAGAATTGG - Intronic
1012791640 6:103705788-103705810 GACTACATGTCATTGAAAATAGG + Intergenic
1015023648 6:128507370-128507392 GCCCACATGGCCTCTAGAGTGGG - Intronic
1018173018 6:161156416-161156438 CTCTAAATGTCATCTGGAATGGG - Intronic
1027219788 7:76206595-76206617 GGCCCCATGTCATCTAGAATAGG + Intronic
1032207977 7:129885590-129885612 GCCCACATGCCAGCTACAATGGG + Intronic
1034726560 7:153341242-153341264 GCCTACCTGTCGTGTAGAGTAGG - Intergenic
1037686261 8:21142010-21142032 GCCTGCTTCTCATCTGGAATAGG - Intergenic
1190304721 X:49075489-49075511 GCCCACATGTCATGTGGTATGGG + Intronic
1191895174 X:65985080-65985102 GCCCCCATGTCATCTGGAACAGG - Intergenic
1198627529 X:138594503-138594525 GCCTACATGACATCTCCACTTGG - Intergenic
1200746194 Y:6905926-6905948 ACCCAAATGTCATCTTGAATTGG + Intergenic