ID: 935315326

View in Genome Browser
Species Human (GRCh38)
Location 2:101827751-101827773
Sequence CAGTATCTTCATATTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 485}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315320_935315326 23 Left 935315320 2:101827705-101827727 CCAGCGTGTTCTTTTCAGCCCAC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG 0: 1
1: 0
2: 2
3: 33
4: 485
935315322_935315326 4 Left 935315322 2:101827724-101827746 CCACTTCCATGTTCACATTCCAC 0: 1
1: 0
2: 7
3: 29
4: 327
Right 935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG 0: 1
1: 0
2: 2
3: 33
4: 485
935315324_935315326 -2 Left 935315324 2:101827730-101827752 CCATGTTCACATTCCACATGGCA 0: 1
1: 0
2: 1
3: 31
4: 209
Right 935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG 0: 1
1: 0
2: 2
3: 33
4: 485
935315321_935315326 5 Left 935315321 2:101827723-101827745 CCCACTTCCATGTTCACATTCCA 0: 1
1: 0
2: 2
3: 36
4: 274
Right 935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG 0: 1
1: 0
2: 2
3: 33
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315326 Original CRISPR CAGTATCTTCATATTGAACA TGG Intronic
901020362 1:6252245-6252267 CAGTTTCTTCATCTGGAAAATGG + Intronic
901850055 1:12009254-12009276 CAGTTTCTTGATTTTGAAAAAGG - Intronic
902165188 1:14564433-14564455 CTGCATCTTCATCTTGAATATGG + Intergenic
902254791 1:15181138-15181160 CAGTTTCTTCATCTTTAAAATGG + Intronic
902791041 1:18768254-18768276 CAGTTTCTTCATCTTTAAAATGG - Intergenic
903278519 1:22236733-22236755 CAGTATCTTCATCTGTAAAATGG + Intergenic
905066767 1:35191681-35191703 CACTATCTTAACATTGAAAAAGG + Intronic
905428910 1:37907500-37907522 CAGTAACTCCATCTTGAATAGGG + Intronic
905770197 1:40632896-40632918 CAGTCTCCTCATATTTAAAATGG - Intronic
907390099 1:54152573-54152595 CAGTTTCTTCATCTGGAAAATGG + Intronic
907662806 1:56408873-56408895 CAGTTTCTTCATATCCAATATGG + Intergenic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
907762710 1:57377382-57377404 AGGTATCTTCATTTTTAACAGGG - Intronic
907844767 1:58194208-58194230 CAGTAGCTTCATATTCAGCTAGG + Intronic
908055816 1:60285695-60285717 CAGTTTCTTCATATATAAAATGG - Intergenic
908069562 1:60443353-60443375 CAGTTTCTTCATTTTTCACAAGG - Intergenic
908572931 1:65427905-65427927 CTGTATCTTGATAGTGAACCAGG + Intronic
908825537 1:68129499-68129521 CAGTAGCTTCACATCGTACAAGG - Intronic
909324214 1:74329203-74329225 CAGTTTCTTCATCTTTAAAATGG + Intronic
910411842 1:86954477-86954499 CAATGTGTTCATATTGAGCATGG - Intronic
910679623 1:89849003-89849025 CAGTTTCTTCACATAAAACAGGG - Intronic
911369891 1:96984219-96984241 CAGTGTCTTCATCTGGAAAATGG - Intergenic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
911568392 1:99492485-99492507 CAGTATCTTCATTTGCAAAATGG + Intergenic
912150684 1:106854940-106854962 CATAATCGTCAGATTGAACAAGG + Intergenic
912155937 1:106920000-106920022 CAGTCTCTTCAGTTTGAATATGG - Intergenic
912173460 1:107128782-107128804 CAGGATCTTAATATGGAACAAGG + Intergenic
912371971 1:109180660-109180682 GAGTATTTTCATATTAAAAAAGG - Intronic
912415141 1:109503146-109503168 CAGTATTTTCATGTTGTAAATGG - Intergenic
912486299 1:110031589-110031611 CAGCAACTCCATCTTGAACAGGG - Intronic
912580452 1:110716561-110716583 CAATTTCTTCATCTTGAAAAAGG - Intergenic
912694056 1:111827655-111827677 CAGTTTCCTCATATATAACATGG - Intronic
913014846 1:114722366-114722388 CAGTTTCTTCATCTTTAAAATGG - Intronic
913267150 1:117056199-117056221 TAGTATCTTCATCTTAAAAATGG + Intergenic
913564514 1:120058751-120058773 CAATATCTTCATCTTTAAAATGG + Intronic
913633616 1:120734813-120734835 CAATATCTTCATCTTTAAAATGG - Intergenic
914285101 1:146218100-146218122 CAATATCTTCATCTTTAAAATGG + Intronic
914546132 1:148668839-148668861 CAATATCTTCATCTTTAAAATGG + Intronic
914620432 1:149401826-149401848 CAATATCTTCATCTTTAAAATGG - Intergenic
915249257 1:154576817-154576839 CAGTTTCTTCATCTGCAACATGG - Exonic
915545201 1:156593050-156593072 CAGTATCTTCATCTGTAAAATGG - Intronic
915863721 1:159475869-159475891 CAGAAACTTCATAGTGAACTAGG - Intergenic
916366622 1:164035960-164035982 CAGTACCTGCTTATAGAACAGGG - Intergenic
916401050 1:164448816-164448838 CAGTATCTCCAGACTGAGCAGGG + Intergenic
916872959 1:168937538-168937560 CAGTATTTTCCTGTTGGACAAGG + Intergenic
917108315 1:171518110-171518132 CAGTATCTTTATTATTAACAGGG + Intronic
917406168 1:174710734-174710756 CAGTATCTTCATAGTGTTGATGG - Intronic
917523528 1:175767593-175767615 CAGTTTCTTCATCTTTAAAATGG + Intergenic
918450518 1:184653207-184653229 CATTATCTCCATCTTAAACAAGG - Intergenic
918901463 1:190425579-190425601 CTGTATCAACATATTTAACAAGG + Intronic
919980802 1:202642119-202642141 CAGTATCTTCATCTGGAAAATGG - Intronic
920605204 1:207376232-207376254 CTGTATTTTCATTTTGAACTGGG - Intergenic
920888433 1:209957171-209957193 TAGTATTTTCAGATTTAACATGG + Intronic
921005306 1:211087113-211087135 ATGTATCTTCATGTTGGACATGG - Intronic
921281926 1:213575853-213575875 CAGCATCCTCATATTGAGCTGGG - Intergenic
921567471 1:216737356-216737378 CAGTTTCCTCATTTTTAACATGG + Intronic
921651096 1:217679343-217679365 CAGTTTCTTCATTTTTAACATGG + Intronic
921713989 1:218400183-218400205 CCATATTTTCATATTGAAAAAGG - Intronic
921722087 1:218483744-218483766 CAGTTTCTTCATCTTTAAAATGG - Intergenic
923864170 1:237921081-237921103 CAGTTTCTTCCTCTTTAACATGG + Intergenic
1065194522 10:23249957-23249979 CAGTTTCTCCATTTTGAAAAAGG + Intergenic
1065938348 10:30541742-30541764 CAGTTTCTTCATCTGCAACATGG + Intergenic
1066303755 10:34119287-34119309 CAGTATCTTCATCTGAAAAATGG - Intronic
1066345211 10:34578606-34578628 CAGTTTCTTCATATGTAAAATGG - Intronic
1068245825 10:54365836-54365858 CTCTATCTACATGTTGAACACGG - Intronic
1069397437 10:68005053-68005075 CAGTAAATTCATTTTGGACAAGG - Intronic
1069626622 10:69871890-69871912 CAGTGTTTTCATCTTGAAAATGG - Intronic
1070006974 10:72433805-72433827 CAGTTTCTTTATTTTAAACAAGG + Intronic
1070409916 10:76129941-76129963 CAGTTTCTTCATATGTAAAATGG + Intronic
1070609239 10:77922234-77922256 CAGTATCTTCATCTGTAAGATGG - Intronic
1071675386 10:87651039-87651061 GAGTGACTCCATATTGAACAGGG + Intergenic
1072847562 10:98849089-98849111 CAGTTTCTTCATTTTAAAAAAGG - Intronic
1074181737 10:111071242-111071264 CAGTTTCCTCATATGGAAAAAGG - Intergenic
1074461663 10:113643903-113643925 CAGTATATTCATATAGAAAGAGG + Intronic
1074661984 10:115670150-115670172 CAGTTTCTTCATCTTTAAAATGG + Intronic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1075449008 10:122534688-122534710 CAGTTTCTTCATATGGAAAGTGG + Intergenic
1075623115 10:123942253-123942275 CAGTGACTCCATCTTGAACAGGG + Intergenic
1075878748 10:125830792-125830814 CACCACCTTCATATTGAAAAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077673960 11:4181392-4181414 CAGTTTCTTCATCTGTAACATGG - Intergenic
1077951650 11:6965186-6965208 CAGTAAAGGCATATTGAACACGG + Intronic
1078653272 11:13215646-13215668 CAGTTTCTTCATCTAGAAAAGGG + Intergenic
1079204522 11:18402677-18402699 CAGGATCTTGATATTGATCATGG - Intronic
1079846144 11:25471087-25471109 CAGTAACATCATATTTAAGATGG + Intergenic
1079944282 11:26722212-26722234 CAGTGTCTTCCTCTTGAAGAAGG + Intronic
1080052900 11:27874854-27874876 CAGTTTCTTCATCTGGAAAATGG - Intergenic
1080775461 11:35382056-35382078 CAGTATCTTCATCTGTAAAATGG - Intronic
1080855027 11:36104689-36104711 CAGTTTCTTCATCTAGAAAAGGG - Intronic
1081363500 11:42207391-42207413 CAGTTTCTTCATATTGTCAATGG - Intergenic
1081768037 11:45626056-45626078 CAGAATCTTCACTTTTAACAAGG - Intergenic
1082182792 11:49140721-49140743 CAGTTTCTTCATATTGTTGATGG - Intergenic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1084279094 11:68074966-68074988 CTGTTTCTTCATATTTAAAATGG - Intronic
1085834050 11:79933517-79933539 AAGTATCTTTATTTTGAAAAAGG + Intergenic
1086121172 11:83305695-83305717 CAGTGTCTTCATTTTCAAAATGG - Intergenic
1086199809 11:84188424-84188446 CAGTTTCTTCATATTTAAAGTGG - Intronic
1087305960 11:96489017-96489039 CAGTTTCTTCATATTGTCAATGG - Intronic
1088485685 11:110338012-110338034 CAGTGACTCCATAGTGAACAGGG - Intergenic
1089009662 11:115122115-115122137 TAGTATCTTCATTTTACACACGG - Intergenic
1089706286 11:120280316-120280338 CAGTTTCTTCATCTTTAAAATGG - Intronic
1090088581 11:123673423-123673445 CAGTTTCTTCATCTGTAACACGG - Intergenic
1091122426 11:133067207-133067229 CAGTTTCTTCATCTGGAAAATGG - Intronic
1092790247 12:12064450-12064472 CAGTTTCTTCATATGTAAAATGG + Intronic
1093133254 12:15417590-15417612 CAGAATCTGCATTTTTAACAAGG + Intronic
1094114855 12:26899878-26899900 CAGTTTCTTCATAATGTTCATGG - Intergenic
1094317857 12:29151576-29151598 CTGGATCTTCATTTTGAACTGGG + Intronic
1094491984 12:30966524-30966546 CAGTTTCTTCATCTGGAAAATGG - Intronic
1095152582 12:38812810-38812832 CTGCATCTTTATATTGAAGAAGG - Intronic
1095168473 12:39004069-39004091 CAGTTTCTTCATCTGGAAAATGG + Intergenic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1095654525 12:44653279-44653301 CAGTTTCTTCATCTTTAAAATGG - Intronic
1095801611 12:46274706-46274728 CAGTTTCTTCATATTTAAAATGG + Intergenic
1096601797 12:52734998-52735020 CAGTTTCTTCATTTGTAACACGG - Intergenic
1096718039 12:53502601-53502623 CAGTTTCCTCATATTCAACATGG - Intronic
1098889784 12:75997983-75998005 CAGAATCTTCATCTTGAAAATGG - Intergenic
1098940542 12:76529927-76529949 TAGTGTCTTCATTTTGAAAATGG - Intronic
1099855833 12:88164674-88164696 CAATAACTTAAAATTGAACAGGG - Intronic
1101913795 12:108880419-108880441 CAGTTTCTTCACCTGGAACATGG + Intronic
1101953039 12:109191088-109191110 CAGTTTCCTCATATGGAAAATGG - Intronic
1102029341 12:109731025-109731047 CAGTTTCTCCATATGAAACATGG - Intronic
1102186863 12:110955834-110955856 CAGTTTCTTGATCTTGAAAATGG - Intergenic
1102586303 12:113925458-113925480 CAGTTTCTTCATCTGTAACATGG - Intronic
1103189978 12:118993096-118993118 CAGTTTCTTCATCTTTAAAATGG - Intronic
1103370351 12:120414587-120414609 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1103535576 12:121631585-121631607 CAGTTTCTTCATCTTTAAAATGG + Intronic
1103740300 12:123086615-123086637 CAGTTTCCTCATATGCAACATGG - Intronic
1104318143 12:127723261-127723283 CAGTCTCTCCATGTTGAACCTGG - Intergenic
1105693920 13:22869932-22869954 CAGTATCTTCATTCTTAAGAAGG + Intergenic
1106497364 13:30292521-30292543 CAGTATCTCCCTTTGGAACAAGG - Intronic
1108112585 13:47091920-47091942 CAGCACCTTGATATTGAACTTGG + Intergenic
1108381911 13:49862606-49862628 CAGTTACTTCATTTTGAACAAGG - Intergenic
1109283464 13:60384140-60384162 CAGTGGCTTCAGATTGAACAGGG + Intergenic
1110754515 13:79156602-79156624 AAGTATCTTCACATGGAAAATGG + Intergenic
1110890497 13:80691702-80691724 CAGTATCTTCATAATGTTGATGG - Intergenic
1111284765 13:86074979-86075001 CAGTATCTGCTTACTGAAGAAGG - Intergenic
1111515463 13:89325348-89325370 CAGTTTCTCCATTTTCAACAAGG + Intergenic
1111647879 13:91054748-91054770 CAGTTTCTTCATCTTTAATAGGG - Intergenic
1112585815 13:100717761-100717783 AAGTATGTTCTTATTAAACAAGG + Intergenic
1113006023 13:105703065-105703087 AAGTAACTCCATATTGAATAGGG - Intergenic
1114860780 14:26518166-26518188 TACTTTCTTCATCTTGAACAGGG - Intronic
1115532545 14:34340589-34340611 GAGTAACTCCATCTTGAACAGGG - Intronic
1115570373 14:34660837-34660859 CTGTATCTTCATATTTGAAATGG + Intergenic
1115800832 14:36991603-36991625 CAGTTTCTTCATCTATAACATGG - Intronic
1115846776 14:37544389-37544411 CAGTTTCTTCATATTTAAAATGG + Intronic
1116049529 14:39786065-39786087 CTGCATCTTCATGTTGAATAGGG + Intergenic
1116311223 14:43328510-43328532 CAGATACTTCATATTGCACAAGG - Intergenic
1116343703 14:43760138-43760160 CAGTATCTTCATTTTGACTTAGG - Intergenic
1116764454 14:49053250-49053272 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1117777102 14:59194010-59194032 CAGTTTCCTCATCTAGAACATGG - Intronic
1118429812 14:65706177-65706199 CAGTTTCTTCATCTGGAAAATGG - Intronic
1118864766 14:69694352-69694374 CAGTTTCCTCATTTTTAACATGG - Intronic
1119384581 14:74249625-74249647 CAGTTTCTTCATCTAGAAAATGG - Intronic
1119552288 14:75523756-75523778 AAGTATATAAATATTGAACAGGG + Intronic
1119943857 14:78670515-78670537 CAGAAACTCCATATTGAATAGGG - Intronic
1120034872 14:79685281-79685303 TAGTTTCTTCATATTTAAAAGGG - Intronic
1120205866 14:81586817-81586839 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1120354332 14:83411297-83411319 CTGTATCTTCATATTGAAAGTGG - Intergenic
1120589191 14:86355315-86355337 CAGTTTCTTCATCTGGAAAATGG + Intergenic
1120667114 14:87319181-87319203 CAGCATCTTCATCTCTAACATGG + Intergenic
1121009993 14:90514139-90514161 CAGTCTCTTCATTTCTAACAAGG + Intergenic
1121829563 14:97038263-97038285 CAATATCTTCACATTGAGCCAGG - Intergenic
1121948836 14:98150988-98151010 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1122154222 14:99740743-99740765 CAGTTTCTTCATCTTTAAAATGG + Intronic
1123451966 15:20373156-20373178 CAGTGTCCTCATTTTCAACAGGG - Intergenic
1124496496 15:30190863-30190885 CAGTATCTTCATCTGGAAAATGG - Intergenic
1124747079 15:32347785-32347807 CAGTATCTTCATCTGGAAAATGG + Intergenic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127283923 15:57516332-57516354 CAGTTTCCTCATATTTAAGATGG + Intronic
1127452364 15:59129624-59129646 CAGTTTCTTCATAGTGTCCATGG + Intergenic
1130978495 15:88795543-88795565 AAGTTTCTTCATATTGACCTGGG + Intergenic
1130993910 15:88893615-88893637 CAGTTTCTTCATCTTTAAAATGG + Intronic
1131566917 15:93494254-93494276 CAGTTTCTTCATCTGGAAGATGG + Intergenic
1131883938 15:96888869-96888891 CAGTTTCTTCACATAAAACAGGG - Intergenic
1132073354 15:98798928-98798950 CAGTTTCTTCATTTATAACATGG - Intronic
1133576760 16:7098889-7098911 CAGTTTCTTCATCTTTAAAATGG + Intronic
1134673500 16:16073204-16073226 CAGTTTCTTCATCTGGAAAATGG - Intronic
1135008663 16:18852897-18852919 CAGTGTCTTCACCTTTAACAAGG - Intronic
1135605909 16:23824410-23824432 CAGTTTCTTCATCTTTAAAAGGG + Intergenic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1136030533 16:27499513-27499535 CAGCAGCTTCATGCTGAACATGG + Intronic
1136104386 16:28019081-28019103 CAGCAACTTCATCTTGAATAAGG + Intronic
1137771998 16:51023931-51023953 CAGTTTCTTCATATGTAAAATGG - Intergenic
1137946770 16:52740526-52740548 CAGTATCTTCATCTGAAAAATGG + Intergenic
1138563233 16:57814571-57814593 CAGTTTCTTCATCTGTAACATGG - Intronic
1140357999 16:74322131-74322153 GAGTGACTTCATCTTGAACAGGG + Intergenic
1140861284 16:79020432-79020454 CAGTTTCTTCATATATAAAATGG + Intronic
1141917922 16:87112914-87112936 CAGTCTCTTCATCTTTAAGATGG - Intronic
1141943619 16:87295295-87295317 CAGTTTCCTCATATTTAAAATGG - Intronic
1142753382 17:2001584-2001606 CAGTTTCTTCATCTGGAAAATGG - Intronic
1143379501 17:6487247-6487269 CAGTTTCTTCATCTGGAATATGG + Intronic
1143813025 17:9487904-9487926 CATTGTCTGCATATTCAACAAGG + Intronic
1144204229 17:12967974-12967996 CAGTTTCTTCATATGCAAAATGG + Intronic
1144394339 17:14828962-14828984 CTGAGTCTTCATATTTAACATGG - Intergenic
1144594243 17:16553619-16553641 CAGGTTCTTCATATTCAACATGG + Intronic
1144711566 17:17404726-17404748 CAGTTTCTTCATCTAGAAAATGG - Intergenic
1145014180 17:19386208-19386230 CAGTTTCTTCATCTTTAAAATGG - Intronic
1145838859 17:27976792-27976814 CATTATCTTCATTTTAAAAAGGG - Intergenic
1146935534 17:36810501-36810523 CAGTGTCCTCATCTGGAACATGG + Intergenic
1147692529 17:42325379-42325401 CTGTATCTTCACATGAAACAGGG + Intronic
1147990954 17:44333118-44333140 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1148229136 17:45920355-45920377 CAGTATCTGCAAACTCAACAGGG - Intronic
1149213180 17:54326696-54326718 CAGCAACTCCATCTTGAACAGGG - Intergenic
1149287375 17:55179645-55179667 CATCATCTTCATATTGAATAGGG - Intergenic
1149516644 17:57285938-57285960 CAGTATCTTTTTATTCAACATGG + Intronic
1151052162 17:70990601-70990623 AAGTAACTTCATCTTGAATAGGG - Intergenic
1151407186 17:73896073-73896095 CAGTGTCTTCATCTTAAAAATGG + Intergenic
1151464875 17:74278139-74278161 CAGTTTCTTCATCTCGAAAATGG + Intronic
1153187616 18:2502261-2502283 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1154179872 18:12126242-12126264 CAGTATCTTCACATTTGACTTGG - Exonic
1155224978 18:23721505-23721527 CAGTAGCTTCATATTGGCCATGG + Intronic
1155984653 18:32217401-32217423 CAGTATCTTCATCTAGAAAATGG - Intronic
1156202100 18:34845188-34845210 CAGTATGTTCAAATTATACAAGG - Intronic
1156638866 18:39065594-39065616 CAGTCTCTTCATCTTTAAGAAGG + Intergenic
1156709068 18:39919800-39919822 CTGTATCCTGATAATGAACAAGG + Intergenic
1157118586 18:44886200-44886222 CAGTTTCTTCATGTAGCACATGG + Intronic
1157147235 18:45176273-45176295 CAGTTTCTTCATATATAAAATGG - Intergenic
1157970286 18:52259422-52259444 CAGTATTTACAAATTGGACAAGG + Intergenic
1158382962 18:56955814-56955836 CAGTGTCCTGATATGGAACAGGG - Intronic
1162750060 19:12823914-12823936 CAGTTTCTTCATCTTTAAAATGG - Intronic
1163186938 19:15645445-15645467 CAGTCTCTTCATCTGGAAAATGG + Intronic
1164788524 19:30956878-30956900 CAGTGTCTTCATATATAAAATGG + Intergenic
1164847622 19:31448184-31448206 CAGTGGCTCCATATTGGACAAGG + Intergenic
1165748898 19:38248144-38248166 CAGTATCCTCATCTGGAAAATGG - Intronic
1166838271 19:45680921-45680943 CAGTTTCTTCATCTGGAAAATGG - Intronic
1167449784 19:49560351-49560373 CAGTTTCTTCCTCTGGAACATGG + Intronic
1167549987 19:50153885-50153907 CAGTTTCTTCATATGCAAAAAGG - Intronic
1167735478 19:51292074-51292096 GAGTAACTCCATCTTGAACAGGG - Intergenic
1168024573 19:53634564-53634586 CAGTTGCTTCTTAGTGAACATGG - Exonic
925391565 2:3498464-3498486 CAGTTACTTTATTTTGAACAAGG + Exonic
926496164 2:13591530-13591552 CAGAGTCATCATATTCAACAAGG - Intergenic
928399860 2:30969978-30970000 CAGTTTCTTCATCTGGAAAATGG + Intronic
928624020 2:33120941-33120963 CAGTTTCTTAATATTTAGCATGG + Intronic
928773415 2:34729794-34729816 CAGTATCTTCACCTTAAAAAGGG - Intergenic
929175768 2:38974192-38974214 GAGCATGTTCATATTTAACATGG + Exonic
929469057 2:42172731-42172753 CAGTATATACATTTTGCACATGG - Intronic
930446385 2:51478515-51478537 CTGTATCTTTATATTAAAAATGG + Intergenic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
931826824 2:66008924-66008946 CAATATCTTCAGATTGTATAGGG + Intergenic
932394694 2:71434081-71434103 TAGTAGCTTCATATTGCACTTGG + Intronic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
935644849 2:105325900-105325922 CAGTATCTTCATTTTCAAAGGGG - Intronic
935865749 2:107385847-107385869 CAGTGTCTTCATAAGCAACATGG - Intergenic
936522592 2:113220467-113220489 CAGTTTCTTCATCTGGAAAATGG - Intronic
936523814 2:113229259-113229281 CAGTTTCTTCATATGCAAAATGG + Intronic
936991768 2:118374239-118374261 CAGTTTTTTCATCTTTAACATGG + Intergenic
937246658 2:120498392-120498414 CAGTTTATTCATCTTGAAAATGG - Intergenic
937834477 2:126458458-126458480 CAGTAGCTACAGATTCAACATGG + Intergenic
937884845 2:126892649-126892671 CAGTTTCTTCATCTTTAAAATGG - Intergenic
938122887 2:128646058-128646080 CAGTTTCTTCATCTTTAAAATGG - Intergenic
938613820 2:132977060-132977082 CAGTATCTACTTACTGAACTTGG - Intronic
939024059 2:136990764-136990786 CAGTATCTCCATCTCAAACAAGG - Intronic
939224667 2:139349889-139349911 CAGTTTCTTCATAGTGATGATGG - Intergenic
939876483 2:147584519-147584541 CAGTTTCTTCATAGTGTAAATGG + Intergenic
941601992 2:167554158-167554180 CAGTTTTCTCATATTGAAAATGG + Intergenic
941876819 2:170441995-170442017 CAGCAACTTCATCTTGAATAGGG - Intronic
942124318 2:172808710-172808732 CAGTATCTTCATTTGTAAAATGG - Intronic
942204163 2:173602899-173602921 CAGTATTTGCATTTTGAACTGGG + Intergenic
942639599 2:178047823-178047845 CAGAATCTCCATATATAACATGG - Intronic
943078644 2:183229848-183229870 CAAAATCTTAATTTTGAACATGG - Intergenic
943219037 2:185080157-185080179 CAGTATCTCCTTCTTTAACAAGG - Intergenic
943733407 2:191327476-191327498 CAGTGTCTTCATCTCCAACATGG - Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
944608151 2:201371693-201371715 CAGTTTCTTCATAGTGACGATGG - Intergenic
945356259 2:208843304-208843326 CAGTATCTTGAGGTTGCACAGGG - Intronic
945498621 2:210540653-210540675 CAGTTTCTTCATATACAAAATGG - Intronic
946600785 2:221357673-221357695 CAGTTTCTTCATCTGGAAAATGG + Intergenic
947086256 2:226455990-226456012 CAGTTTCTTCATAGTGTCCATGG - Intergenic
947178834 2:227394431-227394453 CAGAATCTTCATCTTCAAGAAGG - Intergenic
947440409 2:230116178-230116200 CAGTTTCTTCATAGTGTCCATGG + Intergenic
1168859165 20:1033327-1033349 ATGTATCTTCATATGTAACATGG - Intergenic
1170012411 20:11739418-11739440 CAGTTTCTTCATATTGAAAATGG + Intergenic
1172290561 20:33773163-33773185 CAGTGTCTTCATCTTCAAAATGG - Intronic
1172425088 20:34850649-34850671 CAGTCTCTTCATCTTTAAAATGG - Intronic
1172806589 20:37616198-37616220 CAGTTTCTTCATCTTTAACGTGG - Intergenic
1172896577 20:38304480-38304502 CAGTTTCTTCATATATAAAATGG - Intronic
1173006658 20:39144943-39144965 CAGTGTCTTCATCTATAACATGG + Intergenic
1173146513 20:40529340-40529362 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1173168912 20:40706540-40706562 CAGCTTCTTCATATGGAAAATGG + Intergenic
1173336221 20:42114270-42114292 CAGTTTCTTCATATGTAAAATGG + Intronic
1173539389 20:43840163-43840185 CAGTTTCTTCATTTGCAACATGG + Intergenic
1173791723 20:45832416-45832438 CAGTTTCTTCATCTTGAAAATGG + Intronic
1174068605 20:47883839-47883861 CAGTTTCTTCATATGTAAAATGG + Intergenic
1174089033 20:48031906-48031928 CTGGAGCTTCATATTAAACAGGG + Intergenic
1174392645 20:50227279-50227301 CAGTTTCCTCATTTTGAAAATGG + Intergenic
1174839240 20:53886098-53886120 CAGTTTCTTCATATGTAAAATGG + Intergenic
1176983622 21:15411034-15411056 CAGTATCTTCATCTGTAAAATGG + Intergenic
1178486257 21:33021535-33021557 CAGTATCTTCATCTGTAAAATGG + Intergenic
1178971840 21:37185998-37186020 CAGTATTTTTATATTGACAATGG - Intronic
1180566766 22:16675242-16675264 CAGTATCTTCACATTTGACTTGG + Intergenic
1180865416 22:19116053-19116075 CAGTTTCCTCATTTGGAACATGG - Intronic
1182452874 22:30431635-30431657 CAGTGTCTTCATGTGGAATATGG - Intergenic
1182569641 22:31226995-31227017 CAGTTTCTTCATCTGGAAAATGG + Intronic
1183541160 22:38430194-38430216 CAGTTTCCTCATCTTGAAAATGG + Intronic
1184062102 22:42089734-42089756 CAGTTTCTTCATCTTTAAAATGG - Intronic
1184642886 22:45881535-45881557 CAGTTTCTTCATCTTTAACATGG - Intergenic
949411380 3:3768651-3768673 CAGTTTCTTCATTTTTAAAATGG - Intronic
949774581 3:7618240-7618262 CAGTTTCTTCATTTGTAACATGG + Intronic
951628896 3:24697544-24697566 CAGTATCTTCATAGTGTCGATGG + Intergenic
951795282 3:26532074-26532096 CAGTTTCTTCATAGTGTTCATGG + Intergenic
951865684 3:27304747-27304769 CAGCTTCTTCATATTTTACAAGG - Exonic
952354104 3:32569134-32569156 CAGTTTCTTCATCTTTAAAATGG - Intronic
952599387 3:35061095-35061117 CAGTTTCTTCATATAAAAAATGG + Intergenic
952997262 3:38896862-38896884 TATTGTCTTCATATTGATCACGG - Exonic
953004850 3:38968791-38968813 CAGTTTCTTCATCTAGAAAATGG + Intergenic
953085590 3:39663515-39663537 CAATATCTTCATATGTAGCAAGG + Intergenic
953240684 3:41146607-41146629 AAGTATTTTCATTTTTAACATGG - Intergenic
954168918 3:48783886-48783908 CAGTTTCTTCATATGTAAAAAGG + Intronic
954510297 3:51119052-51119074 CAGTTTCTTCATAGTGTCCATGG + Intronic
955697620 3:61652646-61652668 CAGGCTCTTCATTTTAAACAGGG + Intronic
956267883 3:67418141-67418163 CAGTTTCTTCATCTTTAAAATGG + Intronic
956300139 3:67763514-67763536 CAGTATCTTCATAATGTCGATGG + Intergenic
956312166 3:67893472-67893494 CAGTTTCTTCATATGTAAAATGG - Intergenic
956515452 3:70041473-70041495 CAGTTTCTTCATCTAAAACATGG + Intergenic
958012088 3:87892533-87892555 CAGTTTTCTCATCTTGAACAAGG + Intergenic
958209168 3:90446706-90446728 AAGTATCTTCATATAAAACAAGG - Intergenic
958586457 3:96093286-96093308 CAGTTTCTTCATATTGTTGATGG - Intergenic
958793755 3:98683562-98683584 CATAATCTTCATATTCACCAAGG + Intergenic
959758031 3:109923094-109923116 TATTATCTTCCTATTGAACATGG + Intergenic
960173072 3:114485761-114485783 CTGTATCTTCATATGGCAAAGGG - Intronic
960633343 3:119755528-119755550 CTGTGTCTTCACATTGAAGATGG - Intronic
961484572 3:127207983-127208005 CAGTTTCTTCATCTGGAAAATGG - Intergenic
961921601 3:130432249-130432271 CAGTTTCCTCATTTTTAACATGG - Intronic
963300312 3:143590207-143590229 CAGCATCTTCATCTGGAAAATGG + Intronic
963718669 3:148834557-148834579 CAGTATCTTCTGCTTTAACACGG - Exonic
963905822 3:150772970-150772992 CAGTATCTTCATCTGGAAAATGG + Intergenic
965542419 3:169883198-169883220 CAATATCTTCTTATATAACATGG - Intergenic
966018113 3:175168483-175168505 CAGTATCTTCAGGTTTAAAATGG + Intronic
967299187 3:187995629-187995651 CAGTATCTTCATCTGCAAGATGG + Intergenic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
969160702 4:5256131-5256153 CAGTATCTGCATCTCTAACATGG - Intronic
969974129 4:11080728-11080750 CAGCATCCTCACATTGAATAAGG - Intergenic
970309511 4:14767456-14767478 CAGTCTCTTCATATGTAAAATGG - Intergenic
970454408 4:16208267-16208289 TAGTATAGTCATATTCAACATGG - Intronic
970856884 4:20659500-20659522 CAGCCACTTCATCTTGAACAGGG + Intergenic
971060918 4:22968484-22968506 CAGGATCTTCATCTTTAAGATGG - Intergenic
971988924 4:33865998-33866020 CAGTTTCTTCATATTGTCAATGG - Intergenic
972709034 4:41575170-41575192 CAGTGTCTTCATACTTAACATGG - Intronic
973003658 4:44983976-44983998 CAGTAGCTTGATATCGACCATGG - Intergenic
973676909 4:53273122-53273144 CATTATTTTCATATTTATCATGG - Intronic
973938974 4:55883950-55883972 CATTATCTTCCTATTAAAAATGG + Intronic
974298064 4:60030115-60030137 CAAAATCTTCACATTGAACTTGG - Intergenic
974721457 4:65744237-65744259 CAGTGACTCCATCTTGAACAGGG + Intergenic
975764904 4:77656771-77656793 CAGTTTCTTCATAGTGTCCATGG - Intergenic
976790116 4:88868977-88868999 CAGCATCTTCATTTGGAAGATGG + Intronic
977162721 4:93655979-93656001 CAGCATTTTAATATTCAACAAGG - Intronic
978041106 4:104063558-104063580 TAGGATCTTCACATTGAACAAGG - Intergenic
978139288 4:105299115-105299137 CAGTTTCTTCATATTGTCAATGG - Intergenic
978707105 4:111726639-111726661 CAGTCTCTTCAAATTGACAATGG + Intergenic
980277416 4:130672198-130672220 CAGTCTGTTTATATTAAACAGGG - Intergenic
980874060 4:138642949-138642971 CAGTTTCTTTATATGGAAAATGG - Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
983018936 4:162650915-162650937 CTGTGTCTTCATATTGTACTTGG + Intergenic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
983143813 4:164187976-164187998 CAGAATACTCAGATTGAACATGG + Intronic
984089457 4:175353726-175353748 CAGTAACATCATATTGAATGGGG + Intergenic
985016823 4:185644619-185644641 CAGTCTCTTCATCTGTAACATGG + Intronic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986456888 5:7928481-7928503 CAGTGTCTTCATCTTTCACACGG + Intergenic
986840363 5:11689734-11689756 CAGTATCTTCATAAAAAAAAAGG + Intronic
987656740 5:20816668-20816690 CAGTTTCTTCATAGTGACGATGG - Intergenic
988349885 5:30088391-30088413 CAGTATTGTCATCTTGAAAAAGG - Intergenic
988781909 5:34529962-34529984 CAGTTCCTTCATTTTTAACATGG - Intergenic
988819698 5:34869439-34869461 CAGTATCTAACTATTGAATATGG - Intronic
989631587 5:43488666-43488688 CACTATCTTTCTATAGAACATGG - Intronic
989639679 5:43570861-43570883 CTGTAACTTCATGCTGAACAGGG - Intergenic
991370027 5:65908884-65908906 CAGTTTCTTCATATTCAAAATGG + Intergenic
992028507 5:72696167-72696189 CAGTATTTTGACATTGAAGATGG - Intergenic
992698425 5:79314454-79314476 AAGTATCTTCAAGTTGCACAAGG - Exonic
992712824 5:79477554-79477576 CAATCTGTTCAAATTGAACAGGG + Intronic
993133208 5:83925135-83925157 CAGTTTCCTCATATGCAACATGG + Intergenic
993894627 5:93518592-93518614 CAGTTTCTTTATATTTAAAATGG + Intergenic
994015250 5:94957329-94957351 CAGTTTCTTCATATTGTCAATGG - Intronic
994457205 5:100025798-100025820 CAGTATTTACATTTTCAACATGG + Intergenic
994978394 5:106840794-106840816 CAGTTTCTTCATAGTGTCCATGG - Intergenic
996105843 5:119501567-119501589 CAGTGCTTTCATTTTGAACATGG + Intronic
996340744 5:122436251-122436273 CAGTTTCTTCATATGTAAAATGG + Intronic
996428973 5:123349290-123349312 CAATCTCTTCATCTTGAAAATGG + Intronic
996522580 5:124443640-124443662 CAGTATCTTCATGTGTAAAACGG + Intergenic
996571729 5:124939253-124939275 CATTATCTTTATACTGAGCATGG - Intergenic
996910673 5:128654049-128654071 CAGTTTCTTCATAATGTAGATGG + Intronic
997074489 5:130656188-130656210 CAGTTTCTTCATATATAAAATGG - Intergenic
997207400 5:132057813-132057835 CAGTTTCTTCATCTGGAAAATGG + Intergenic
997269477 5:132524862-132524884 CACTTTCTTCATATGAAACATGG + Intergenic
997486769 5:134237429-134237451 TAGTATCTTCATCTGTAACATGG + Intergenic
997616225 5:135247972-135247994 AAGTATCTTACTTTTGAACAGGG - Intronic
998389256 5:141776641-141776663 CAGTTTCTTCATCTGGAAAATGG + Intergenic
999065932 5:148685520-148685542 CAGTTTCTTCATCTTTAAAAGGG - Intergenic
999996963 5:157101555-157101577 CAGTATCTTCATCTGAAAAATGG - Intronic
1000135603 5:158347329-158347351 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1000277550 5:159752096-159752118 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1000351033 5:160353129-160353151 CAGTATCCTCATCTGTAACATGG + Intronic
1000824265 5:166024547-166024569 CTTTATTTTCATATTGAACAAGG - Intergenic
1001518883 5:172376820-172376842 CAGTATCTTCATCTGCAAAATGG - Intronic
1002044664 5:176535193-176535215 CAGTATCTTCATCTGTAAAATGG + Intronic
1004192925 6:13480083-13480105 CAGTTGCTTCATGTTGAAGAGGG - Intronic
1005189792 6:23207852-23207874 CAGTTTCTTCATAATGAAGGTGG - Intergenic
1006629317 6:35419971-35419993 CAGTTTCTTCACCTAGAACAGGG - Intronic
1008307110 6:49916948-49916970 CAGTAACTTCATTTTGTAAATGG - Intergenic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1008500400 6:52175330-52175352 CAGTATCTTCAAAATCAACTAGG - Intergenic
1008583364 6:52926312-52926334 CAGTATATTCATATCCAGCAAGG - Intergenic
1008625238 6:53309252-53309274 CTGTTTCATCATATTGAACTGGG + Intronic
1008782567 6:55125564-55125586 CAGAATCATCATATTCACCAAGG - Intronic
1009629578 6:66177452-66177474 CAGTGTCTTTATATTTAAAATGG - Intergenic
1010610242 6:77945958-77945980 TAGTCTCTTCAGAGTGAACAAGG - Intergenic
1010929441 6:81782816-81782838 TAATATATTCTTATTGAACATGG - Intergenic
1011138539 6:84127130-84127152 CAGTGCCTTCATATTGAGCTTGG + Intronic
1011710673 6:90049959-90049981 CATTTTCTTGAAATTGAACAAGG + Intronic
1012955188 6:105562471-105562493 CAGTATTTTCATTTTGCACTAGG + Intergenic
1013488869 6:110625230-110625252 CAGAATCTACATTTTTAACAAGG + Intronic
1014139940 6:117929982-117930004 CAGTATCTTCATCTTTAAATTGG - Intronic
1014141971 6:117954136-117954158 CAGTGGCTTCATCTTGATCATGG + Intronic
1014339011 6:120179298-120179320 CAGCATGTTCACATTGCACATGG + Intergenic
1014930819 6:127333605-127333627 CAGTAGCTTGAAATTGACCATGG + Intronic
1014997269 6:128164570-128164592 CAATATCTTCATCTTTAAAAAGG + Intronic
1015712618 6:136158701-136158723 CAGTGCCTTCATATTGAACTTGG - Intronic
1016100136 6:140089792-140089814 CAGTTAGTTAATATTGAACAGGG + Intergenic
1016483293 6:144506339-144506361 CAGTTTCTTCATAGTGTCCATGG + Intronic
1016900491 6:149096429-149096451 CAGGCTCTTCACTTTGAACATGG - Intergenic
1016942362 6:149493428-149493450 CAGTATCTTCAGCATGACCAGGG - Intergenic
1017090028 6:150750947-150750969 CAGTGTCTTCATCTGTAACATGG + Intronic
1017933688 6:158984725-158984747 CAGTTTCTTCATTTGGAAAATGG + Intronic
1017969000 6:159293793-159293815 CACTATGTTCATAATGAACTTGG + Intergenic
1018880817 6:167878245-167878267 CAGTTTCTTCATCTTCAAAACGG + Intronic
1020718109 7:11704261-11704283 CAGCATTTTCATATTGAATAGGG + Intronic
1021014874 7:15519719-15519741 CAGTTTCTTCATAGTGACAATGG - Intronic
1022400554 7:30032491-30032513 CAGTGTCTTCATCTGGAAAATGG - Intronic
1022593947 7:31693534-31693556 CAGTTTCCTCATCTTCAACATGG + Intronic
1022747127 7:33183922-33183944 GAGTACCTTAAGATTGAACATGG - Intronic
1023166499 7:37348479-37348501 TAGAATCTTAATATTAAACATGG - Intronic
1024055020 7:45654575-45654597 CAGTATCTTACTTTTTAACAAGG + Intronic
1024144515 7:46499508-46499530 CAGTTTCTTCATAGTGTCCATGG - Intergenic
1024149991 7:46561624-46561646 CAGTTTCTTCATAGTGTCCATGG + Intergenic
1024556709 7:50610018-50610040 CAGCATCTTCATATCAACCATGG - Intronic
1024677776 7:51652889-51652911 CAATATCCTCATATTTAAAATGG + Intergenic
1027602297 7:80254276-80254298 CTGTATCTTCATATGGTATAAGG - Intergenic
1028295571 7:89126029-89126051 CAATATCTTCAGATTGTCCATGG + Intronic
1029032823 7:97486891-97486913 AATCATTTTCATATTGAACAGGG - Intergenic
1029478022 7:100796715-100796737 CAGAATCTGCATTTTCAACAAGG + Intronic
1029976108 7:104835680-104835702 CAAATTCTTCATATTGAAAATGG + Intronic
1030441157 7:109591682-109591704 CAGTATGTTACTCTTGAACAAGG - Intergenic
1030610126 7:111680141-111680163 CACCATCTCCATCTTGAACAGGG - Intergenic
1031025655 7:116676905-116676927 CTGTATCTTCATCTTTAACATGG - Intronic
1032161154 7:129511847-129511869 CAGTATTTCTGTATTGAACAAGG - Intronic
1032396125 7:131591413-131591435 CAGTTTCCTCATATGTAACACGG - Intergenic
1033871295 7:145756926-145756948 CAGTATATTCAAATTTATCATGG + Intergenic
1035714420 8:1743237-1743259 CAGGATCTTCATCTAGAGCAGGG - Intergenic
1036516790 8:9451711-9451733 CAGTTTCATCATTTTGAATAGGG - Intergenic
1036933619 8:12979723-12979745 CAGAATCTTCATATTTATCTTGG + Intronic
1037258065 8:16977918-16977940 CAGTTTCTTCATAGTGTAAATGG + Intergenic
1037266535 8:17068187-17068209 CAGTAACTTCATATGAAATAAGG + Intronic
1037364020 8:18103651-18103673 CAGTGTCTTCAGACTGAGCAGGG - Intergenic
1038131347 8:24735087-24735109 CAGTATTTTCATATTACATAGGG + Intergenic
1038296902 8:26301037-26301059 CAGTATCTACTTATTTCACAGGG - Intronic
1039978201 8:42384680-42384702 CGGTGTCTTCATTTTTAACATGG - Intergenic
1041058756 8:54015703-54015725 CAGTATCAGCATATCTAACAAGG + Intronic
1042511217 8:69613575-69613597 CAGTCTCTTCATATCTAAAATGG - Intronic
1042701823 8:71623954-71623976 CAGTATCTCCATTTTGCAAATGG + Intergenic
1042757008 8:72225868-72225890 CATTATCATCCAATTGAACAGGG + Intergenic
1043309340 8:78838988-78839010 CATTATCTTCATACTGACAAAGG + Intergenic
1043365377 8:79526868-79526890 CAGTTTCTTGATCTTGAAAATGG - Intergenic
1043395141 8:79828221-79828243 TTGCATCTTCATACTGAACAAGG + Intergenic
1045113308 8:98953799-98953821 CTGTAGCTTGATAGTGAACAAGG - Intergenic
1046727591 8:117691883-117691905 CAGCATTTTCATTTTGAAAAGGG + Intergenic
1047445238 8:124913544-124913566 CAGTATCTTCATTTGTAAAATGG + Intergenic
1047640383 8:126813602-126813624 CAGTTTCTTCATAATATACATGG + Intergenic
1048050214 8:130809316-130809338 CAGTTTCTTCATCTAGAAAATGG + Intronic
1048352919 8:133630412-133630434 CAGTATCTCCATCTGGAAAATGG - Intergenic
1049204092 8:141355338-141355360 CAGTTTCTTCATTTGTAACATGG + Intergenic
1050080557 9:1911342-1911364 CAGTTTCCTCATCTTGAATATGG - Intergenic
1050117180 9:2275109-2275131 CAGTTTTTTCATTTTTAACATGG - Intergenic
1050173326 9:2844765-2844787 CAGTTTCTTCATCTGGAAAATGG - Intergenic
1050908640 9:11038466-11038488 CAGTAACTCCATTTTGAATAGGG + Intergenic
1051121975 9:13761422-13761444 GAGTGTCTTCATCTTGAAGAGGG - Intergenic
1051495499 9:17718419-17718441 CAGAATCTGCATTTTTAACACGG - Intronic
1051841023 9:21398464-21398486 CAATTTCTTCTTATTGAAAAAGG + Intergenic
1051908188 9:22120940-22120962 CTGTCTCTTCATATGTAACATGG - Intergenic
1055442713 9:76352476-76352498 CAGCAACTTCATCTTGAATAGGG - Intronic
1056006789 9:82281082-82281104 CAGTATTTTAATAATAAACAGGG - Intergenic
1056508226 9:87277766-87277788 CATTGTCTTTATATTGTACAAGG - Intergenic
1057825027 9:98366128-98366150 CAGTTTCCTCATCTAGAACATGG + Intronic
1057873687 9:98736771-98736793 CAGTATGTTTTTATTGAACTCGG - Intronic
1057888761 9:98852155-98852177 CAGTAACTCCATCTTGAACAGGG - Intergenic
1058401135 9:104620785-104620807 CACTATCTTCATCTATAACATGG + Intergenic
1058920501 9:109609899-109609921 CACTATGTTCATATTTAGCATGG + Intergenic
1059402577 9:114079520-114079542 CAGAATCTTCAAAGGGAACATGG + Intergenic
1059465955 9:114469025-114469047 CAGTTTCTTCATCTAGAAAATGG + Intronic
1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG + Intergenic
1060237213 9:121873245-121873267 CAGTTTCTTCGTCTGGAACAGGG - Intronic
1060307167 9:122424364-122424386 CAGTATCTTCATTGGAAACACGG + Intergenic
1060521631 9:124297384-124297406 CAGTTTCTTCATCTGGAAAATGG - Intronic
1060527154 9:124327143-124327165 CAGTTTCTTCATATGAAAAATGG - Intronic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1186446930 X:9638139-9638161 CAGTCCCTCCACATTGAACATGG - Intronic
1188331280 X:28874648-28874670 CAGCATCCTTATAATGAACATGG + Intronic
1188394055 X:29658347-29658369 CATTATCTCCATGTTGACCACGG + Intronic
1189109774 X:38276925-38276947 CAGTAACTTGATATTCAGCATGG - Intronic
1189409622 X:40758542-40758564 CAGTAGCTTCTCAGTGAACATGG - Intergenic
1189882888 X:45510314-45510336 CAGTTTCTTAATATGTAACATGG + Intergenic
1190258569 X:48783439-48783461 CAGTTTCTTCATCTGGAAAACGG - Intergenic
1190472033 X:50791845-50791867 CAGTATGTACATATAGAGCAAGG + Intronic
1191019565 X:55844704-55844726 AACTATCATCAGATTGAACAGGG + Intergenic
1191632154 X:63333103-63333125 CAGTTTCTTCATAGTGTAGATGG - Intergenic
1191716987 X:64200545-64200567 CAGTTTCTTCATATAGAAATGGG + Intronic
1191914844 X:66190260-66190282 CATTTTCAACATATTGAACAGGG + Intronic
1191974753 X:66859795-66859817 CAGTTTCTTCATAGTGCCCATGG - Intergenic
1192090410 X:68149370-68149392 CAGTAGCTTCATATCTACCATGG - Intronic
1192889179 X:75370210-75370232 GAGTATCTTCATTTTGCAAACGG + Exonic
1193428538 X:81371261-81371283 CAATTTCTTCATATATAACATGG - Intergenic
1194171847 X:90595765-90595787 CAGTCTCTCAATATTGAACCAGG - Intergenic
1195636707 X:107125125-107125147 CTTCATCTTCATGTTGAACAGGG - Intronic
1196387440 X:115173818-115173840 CATGGTCTTCACATTGAACAGGG - Intronic
1196578413 X:117349784-117349806 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1197071073 X:122298660-122298682 CAGTTTCTTCATATTGTTGAGGG + Intergenic
1197937317 X:131753121-131753143 CGGTATCTTGGTATAGAACATGG - Intergenic
1198405441 X:136307538-136307560 CAGGCTCTTCATATTTACCAAGG - Intronic
1198422830 X:136484897-136484919 GAGTATGTGCATTTTGAACAAGG - Intergenic
1198488817 X:137117162-137117184 CAGTTTCTTCATGTTTAAAATGG - Intergenic
1200415876 Y:2909337-2909359 CAGTTTCTTTATATTGCATATGG + Intronic
1200779581 Y:7202204-7202226 CAGTATCTTCATACTAGACATGG - Intergenic