ID: 935315563

View in Genome Browser
Species Human (GRCh38)
Location 2:101830281-101830303
Sequence CATTGTGACTTCATTGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315560_935315563 29 Left 935315560 2:101830229-101830251 CCAGAATGTAAATTCTGGGAATG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315563 Original CRISPR CATTGTGACTTCATTGTAGT AGG Intronic
901076138 1:6555782-6555804 TATTGTAACTTCATTGAAATTGG + Intronic
903979830 1:27177660-27177682 CACTGGGAGTTCATTGTAGAAGG + Intergenic
907232305 1:53011231-53011253 GATTATGACTTTATTGTACTTGG + Intronic
909665985 1:78134090-78134112 CTTTGTGTACTCATTGTAGTTGG + Intronic
914458339 1:147857790-147857812 CATTGTGTCTTCATTCTCATTGG - Intergenic
917520258 1:175742544-175742566 CCTTCTGACTTCATGGTGGTAGG - Intronic
917614698 1:176729475-176729497 CATTGTGTCTTCATTCTCATTGG - Intronic
918184242 1:182113196-182113218 CATTGTGACTTTATAAGAGTGGG + Intergenic
919758495 1:201081359-201081381 CAGTGTTACTTGTTTGTAGTGGG + Intronic
920530548 1:206698961-206698983 CTTTGTGACTCCATTATAATTGG + Intronic
920894617 1:210033750-210033772 CATTGTGCCTTGATTTTAGTAGG + Intronic
921201766 1:212813337-212813359 CATTGGGAGGTCATTGTAATAGG - Intronic
923795332 1:237148838-237148860 CTTTGTGATTTTATTGTCGTTGG + Intronic
924688325 1:246319720-246319742 CTCTGTTACTTCATTGTTGTTGG - Intronic
1063578762 10:7286610-7286632 CATAGTATCTACATTGTAGTAGG + Intronic
1063992432 10:11580636-11580658 GACTGTGACTTCATTGTCCTAGG + Intronic
1064502469 10:15989168-15989190 CATTGTGATTTCTTTTTATTAGG - Intergenic
1065500898 10:26381380-26381402 CATTGAGCTTTCATTCTAGTGGG + Intergenic
1068209976 10:53908997-53909019 CATTGTGACTTCCACATAGTAGG + Intronic
1070719187 10:78744732-78744754 CGCTGTGACTACATTGTAGCTGG - Intergenic
1072063945 10:91846862-91846884 CATTGTAACTTAATTGTATCTGG - Intronic
1072370541 10:94762465-94762487 CATTCTGGTTTCATTGTACTAGG - Intronic
1073596605 10:104806763-104806785 CTTTATGATTTCTTTGTAGTTGG - Intronic
1076181138 10:128409078-128409100 CATTTTGACTTGATTTTTGTTGG + Intergenic
1077710749 11:4534361-4534383 CATTGTGTCTTCATTCTCATTGG - Intergenic
1079995676 11:27292911-27292933 AACTGTAAGTTCATTGTAGTTGG - Intergenic
1080392696 11:31863052-31863074 CATTGTTACTTTATTGTTGTTGG + Intronic
1082756438 11:57081190-57081212 CATTGGGACTACATTTTAATGGG - Intergenic
1082896833 11:58200770-58200792 CATGGTGACTTTAGGGTAGTGGG + Intergenic
1083024439 11:59538110-59538132 GAGTGTGATTTCATTTTAGTAGG + Intergenic
1087094841 11:94308218-94308240 CTTTGAGACTTCAGTGCAGTGGG - Intergenic
1087585941 11:100121757-100121779 CATGGAGATTCCATTGTAGTGGG + Intronic
1089319353 11:117614387-117614409 GATTCTGATTTCATTGTACTGGG + Intronic
1092006586 12:5075310-5075332 CTTTTTGACATCATTGCAGTTGG + Intergenic
1092332412 12:7597144-7597166 CATTGTGTCTTCATTCTCATTGG - Intergenic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1094114924 12:26900761-26900783 CATTGTGTCTTCATTCTCATTGG - Intergenic
1095674513 12:44900560-44900582 CATTGTGTCTTCATTCTCGTTGG - Intronic
1095746025 12:45659956-45659978 CATTCTGATTTCAGTCTAGTAGG - Intergenic
1099037043 12:77601545-77601567 TAATGGGACTTCAATGTAGTAGG + Intergenic
1099540455 12:83901733-83901755 CGTTGTGACTTCATTCTCATTGG - Intergenic
1106327329 13:28706464-28706486 AATTGTGACTTCATTATTCTAGG - Intronic
1108479542 13:50854451-50854473 CAACATGACTTCATAGTAGTTGG - Intergenic
1108599472 13:51979523-51979545 AACAGTGACTTGATTGTAGTTGG + Intronic
1109717704 13:66237808-66237830 CATTGTGACTTAAGTGCACTCGG - Intergenic
1111095945 13:83516009-83516031 CATTGTGAATTCTTTGTATTGGG + Intergenic
1112929611 13:104717882-104717904 CATTGTCAGTACATTGTACTGGG - Intergenic
1118130034 14:62952769-62952791 CATTTGGACCTCATTCTAGTAGG - Intronic
1118432277 14:65731258-65731280 CTTTGTGACTTCACTGTACCTGG - Intronic
1118979978 14:70708491-70708513 CATGGAGCTTTCATTGTAGTTGG + Intergenic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1127359215 15:58230327-58230349 CACTTTGACTTCATTTGAGTGGG - Intronic
1130327498 15:82892721-82892743 CCTTGTGACATCATAGAAGTAGG + Exonic
1133067905 16:3222806-3222828 CCAGGTGTCTTCATTGTAGTGGG - Exonic
1133893363 16:9902751-9902773 CATTGTGTATTCATGGGAGTAGG - Intronic
1136035809 16:27539242-27539264 CATTTTGACTTCACTGTTGAAGG + Intronic
1143527566 17:7481432-7481454 CATTGTGACATGGTTGGAGTGGG - Exonic
1143944914 17:10582492-10582514 GATTGTGATTTGATTGTTGTGGG + Intergenic
1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG + Exonic
1149035310 17:52127519-52127541 CATTGTTACTTCATTATTGGAGG - Intronic
1149357713 17:55860196-55860218 CATAGTGGCTTCAATGTTGTGGG - Intergenic
1149941211 17:60868882-60868904 AATTGTGAATTCAGTTTAGTGGG + Intronic
1154115402 18:11609511-11609533 CACTGTGACCTCATTGGAGTTGG - Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155204055 18:23542382-23542404 CATTGTAAGGTCATTGTAGGTGG - Intronic
1157367567 18:47079744-47079766 CATTGTGTCCTCATGGTAGTAGG + Intronic
1162826698 19:13256844-13256866 CATTCTGACATCAGTGGAGTGGG - Intronic
1165980910 19:39722641-39722663 CATTGTGTCTTCATTCTCATTGG - Intergenic
1166275927 19:41753885-41753907 CATTGGGAGTTCCTTCTAGTTGG + Intronic
926540126 2:14165975-14165997 AAGTGTGACTTCAGTGTAATGGG - Intergenic
930160400 2:48149495-48149517 CATTGTGACTTCAAGGTATCTGG + Intergenic
930426113 2:51215106-51215128 CATTTTAACTTCATTGTGCTTGG + Intergenic
930579221 2:53189681-53189703 CTTTGTGACTGCATTGCAGGTGG + Intergenic
931078706 2:58744920-58744942 TATTGTGACTGTACTGTAGTAGG + Intergenic
931564551 2:63601756-63601778 CATTTTGTCTTCACTGTACTTGG + Intronic
934872085 2:97875665-97875687 CATTGTGTCTTCATTCTCATTGG - Intronic
935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG + Intronic
937775473 2:125770531-125770553 CATTTTGAGTTCTTTGAAGTCGG + Intergenic
941480737 2:166007171-166007193 CACTGTGACTTATGTGTAGTGGG - Intronic
942200191 2:173562864-173562886 CATTGTGTCTTCATTCTCATTGG - Intergenic
943692539 2:190882278-190882300 TTTTGTGACTTCATTGTGATAGG + Intronic
945371414 2:209023115-209023137 CATTGTGTCTTCATTCTCATTGG - Intergenic
946956627 2:224937448-224937470 CATGAAGAATTCATTGTAGTTGG - Intronic
1172261305 20:33568266-33568288 TATTGTGACTTCAATGTTTTTGG - Intronic
1172884883 20:38224235-38224257 CATTCTCACTTCCATGTAGTGGG + Intronic
1173272596 20:41551556-41551578 CTTTTTGACTTCATTTTATTGGG - Intronic
1173357814 20:42311147-42311169 CATCGTGTTTTCATTCTAGTGGG - Intronic
1173644974 20:44627601-44627623 CATGGAGACTGCATTCTAGTAGG - Intronic
1175510382 20:59520239-59520261 CATTGTGACTTCATTTCCTTTGG - Intergenic
1177092169 21:16782738-16782760 CATTGTGTCTTCATTCTCATTGG - Intergenic
1178577833 21:33810893-33810915 GCTTGGGACTTCACTGTAGTTGG + Intronic
1178964521 21:37103747-37103769 CATTGTGAGGGCCTTGTAGTGGG + Intronic
1180578786 22:16809532-16809554 CACTGTGACTTCACTGTTGTGGG - Intronic
949453590 3:4214355-4214377 CATTGTGTCTTCATTCTCATTGG - Intronic
949909524 3:8890073-8890095 AAATGTGATTTCATTGTTGTGGG - Intronic
951079233 3:18431525-18431547 CATTCTGATTTAATTGCAGTGGG - Intronic
951098018 3:18654370-18654392 CATACTGACTTCATTTTATTCGG + Intergenic
952742115 3:36744058-36744080 AATTGTTACTTCATCTTAGTAGG + Intergenic
955913927 3:63887021-63887043 CATTGAAACTTCATGGGAGTGGG - Intronic
956711593 3:72042856-72042878 TACTGTGACTTCAGGGTAGTGGG - Intergenic
956711863 3:72046069-72046091 TACTGTGACTTCAGGGTAGTGGG - Intergenic
958621831 3:96572479-96572501 CATTGTGTCTTCATTCTCATTGG + Intergenic
960312958 3:116139404-116139426 CATTATGACATCAATGAAGTTGG + Intronic
960502970 3:118459656-118459678 CATTGTGTCTTCATTCTTGTTGG - Intergenic
961221281 3:125202230-125202252 CATTATCAATTAATTGTAGTAGG - Intronic
962158145 3:132970723-132970745 CATTCTGAATTCATTGTTGCTGG + Intergenic
962954434 3:140251210-140251232 GATAGTGACTTCATTGTTCTCGG + Intronic
965990141 3:174807713-174807735 CATTTTGTTTTCTTTGTAGTTGG + Intronic
966713225 3:182990284-182990306 CCTTGTAACTTCACCGTAGTTGG + Intergenic
971099322 4:23445661-23445683 GATAGTGATTTCATTGTAGCAGG + Intergenic
971171137 4:24234129-24234151 CATTGTGCTTTCATTTCAGTAGG - Intergenic
971373365 4:26036122-26036144 CATTGTAGCTGCATTGTAGCTGG + Intergenic
972196437 4:36658975-36658997 CATTGTGCCTTCATTATCATTGG - Intergenic
973047710 4:45555072-45555094 CATGATGTCTTCAGTGTAGTCGG + Intergenic
974265854 4:59584825-59584847 CATTGTGTCTTCATTCTCATTGG - Intergenic
975031940 4:69631800-69631822 AATTGTGATTTCATTAAAGTTGG - Intronic
975306359 4:72853719-72853741 CATTGTGTCTTCATTCTCATTGG - Intergenic
975652233 4:76605184-76605206 CATGATGACTTCAATGTTGTCGG + Intronic
976539578 4:86258009-86258031 CATTGTGACTTTTCTCTAGTAGG - Intronic
976861771 4:89674250-89674272 CATTGTGTCTTCATTCTCATTGG - Intergenic
978418675 4:108506032-108506054 CATTGTGTCTTCATTCTCATTGG - Intergenic
979564588 4:122139862-122139884 CATTTTGACTTGATTGTATATGG + Intergenic
980157346 4:129123727-129123749 CATTGTGTCTTCATTCTCATTGG + Intergenic
983087322 4:163463020-163463042 CATAGTGACTTCATTTAAGGAGG + Intergenic
983788320 4:171761885-171761907 CATTGTGCCTTCATTCTCATTGG - Intergenic
988772306 5:34444983-34445005 CATTGTGTCTTCATTCTCATTGG + Intergenic
989786534 5:45338740-45338762 CACTGTGACTTGAATGTAGTAGG + Intronic
990460226 5:56024708-56024730 CATTCTGAGTTCATTGTTCTGGG + Intergenic
991953525 5:71970164-71970186 CATACTGAATTCATTGTAGTTGG + Intergenic
993745782 5:91595261-91595283 CATTATGAATTCAATGTTGTAGG + Intergenic
993843128 5:92905816-92905838 GATGGTGACATCATGGTAGTTGG + Intergenic
993867117 5:93209089-93209111 CATTGCCACTGCATTGTAGTTGG + Intergenic
994720291 5:103372412-103372434 CATGGTGAATTCATTACAGTGGG + Intergenic
1005823150 6:29614673-29614695 TATTGTTACTTCATTATGGTTGG - Intronic
1006198063 6:32260288-32260310 CATTGTGTCTTCATTTTCATTGG + Intergenic
1009762679 6:68028095-68028117 CCTGGTGCCTTCATTCTAGTAGG - Intergenic
1011062738 6:83290321-83290343 CATTGTGTCTTTGTTCTAGTTGG + Intronic
1011199580 6:84820769-84820791 CATTGTGTCTTCATTCTTATTGG + Intergenic
1011573361 6:88764665-88764687 CATGGTGACTTGTTTATAGTAGG - Intronic
1011644042 6:89441100-89441122 CACTGTTACTTCACTATAGTGGG + Intronic
1011872520 6:91913717-91913739 CATTGTGATTTCATTGTTTGAGG + Intergenic
1013295599 6:108755892-108755914 CAGTGTGACTTCATCACAGTTGG - Intergenic
1014187566 6:118453336-118453358 CATTGTGACTTCATTGCTTGTGG + Intergenic
1014588142 6:123227389-123227411 CCTAGGGACTTCATTGTAGTTGG - Intronic
1015477959 6:133674671-133674693 CATTGTAAATTCATTGTAATTGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017743453 6:157426873-157426895 AACGGAGACTTCATTGTAGTGGG + Intronic
1018347437 6:162916121-162916143 CATTTTGACTTCATTCTTGAAGG + Intronic
1020020842 7:4867338-4867360 CATTGTGTCACCATTTTAGTAGG + Intronic
1020523341 7:9223501-9223523 CATAGTGATTTCATTTTATTTGG + Intergenic
1020757716 7:12224739-12224761 CATTTTGATTTCATTGTATTTGG + Intronic
1021706344 7:23371910-23371932 CACTGTGACTTCAGTGTGGCTGG - Intronic
1022240020 7:28501749-28501771 AATTGTGGCTTGATTGCAGTTGG + Intronic
1024383752 7:48727442-48727464 AATGATGACTTCATTGTTGTTGG - Intergenic
1024972306 7:55082035-55082057 CATTGTGAAATCACTGGAGTGGG - Intronic
1027766204 7:82345944-82345966 CATTGTGACAGAATTTTAGTGGG + Intronic
1027986596 7:85299381-85299403 CATTCTGATTTCTTTGTACTGGG - Intergenic
1028982512 7:96982163-96982185 GATTGTGAGTTCCTTGTGGTAGG - Intergenic
1030788168 7:113688182-113688204 CATTTTAACATCATTGAAGTAGG - Intergenic
1032650198 7:133869542-133869564 CATAGTGCATTCCTTGTAGTAGG + Intronic
1032985586 7:137333501-137333523 CTTTGTGACTTCCTTGAAGACGG - Intronic
1033325055 7:140370770-140370792 CATTGTGATTTAATTGAAGTAGG - Intronic
1037094915 8:14974568-14974590 CATTGTGATTTAATTGGTGTGGG - Intronic
1037282575 8:17258964-17258986 CATTGTGACTTCATTTATTTGGG + Intronic
1037537043 8:19834534-19834556 CATACTAACTTCATTGTAGTAGG + Intronic
1037691621 8:21185871-21185893 TTTTGTGACTTCATTTTAATTGG + Intergenic
1037713943 8:21380747-21380769 CATTGTAAATTCAGTGTATTTGG + Intergenic
1038111248 8:24501141-24501163 CATTGTGATTTAATTGTTATTGG + Intronic
1039928925 8:41965043-41965065 CAGTGTGACTTGCATGTAGTAGG - Intronic
1042195864 8:66231456-66231478 CATTGTGTCTTCATTCTCATTGG - Intergenic
1044070043 8:87748413-87748435 CATAGTGATTTCATTGTCTTTGG + Intergenic
1044132733 8:88545892-88545914 GATTGTGACTTTATTGTTGCTGG - Intergenic
1044592277 8:93925731-93925753 AATTGTGATTTTATTGTAATTGG + Exonic
1046763322 8:118043661-118043683 CACTGTGTCTGCATTGGAGTTGG - Intronic
1048110839 8:131466510-131466532 CTTTGTGACTTCATTTTTGATGG - Intergenic
1050469720 9:5974364-5974386 CTTTGTTACTTCATTTTGGTTGG - Intronic
1052542815 9:29832643-29832665 AATAGTGACTTTTTTGTAGTAGG - Intergenic
1055088683 9:72340250-72340272 TATTGTGTCCTCAATGTAGTTGG + Intergenic
1055661838 9:78511778-78511800 CATTGTGAGTTCATGTTACTTGG + Intergenic
1056673646 9:88654209-88654231 CCTTGTGTTTTCATTGCAGTGGG + Intergenic
1056826952 9:89883019-89883041 CATTGTGTGTTCATTGTATAGGG - Intergenic
1057166557 9:92931791-92931813 CACAGTGACTTCATTGTGCTTGG - Intergenic
1058111082 9:101030819-101030841 TTTTGTGACTTCTTTGAAGTGGG + Intronic
1058427833 9:104890890-104890912 CATTGTTACTTCAGTTTACTAGG - Intronic
1059826886 9:118040332-118040354 CATTATGACAGCATTGTAATTGG - Intergenic
1059975671 9:119714211-119714233 CACTGTTACTTGATAGTAGTTGG + Intergenic
1188729362 X:33627944-33627966 CATTGTATTTTCAGTGTAGTTGG + Intergenic
1190436780 X:50433445-50433467 CATTGAGATTTCACTGTATTGGG + Intronic
1192976924 X:76296359-76296381 CATTGTGTCTTCATTCTCATTGG + Intergenic
1194380420 X:93183009-93183031 TATTCTGATTCCATTGTAGTTGG + Intergenic
1195226685 X:102802400-102802422 CATTGTGTCTTCATTCTCATTGG + Intergenic
1195580010 X:106491007-106491029 CATTGTGTCTTCATTCTTATTGG + Intergenic
1195590033 X:106613580-106613602 CATTGTGACAACATTGTAAAAGG - Intronic
1196587497 X:117446377-117446399 CATTGTGCCTTCATTCTCTTTGG - Intergenic
1197062804 X:122201558-122201580 CATAGTGACTTCATTTTCTTTGG - Intergenic
1197896378 X:131319862-131319884 CATGGTGACTTCAGGGTAATTGG + Intronic
1197991570 X:132324297-132324319 CATTGTGTCTTCATTCTCATTGG - Intergenic
1199286394 X:146059243-146059265 AGTTGTGACTTTATTGTGGTGGG + Intergenic
1201785908 Y:17778928-17778950 GACTGTGACTTCCTTGTTGTGGG - Intergenic
1201815645 Y:18127060-18127082 GACTGTGACTTCCTTGTTGTGGG + Intergenic
1201848442 Y:18450195-18450217 CATTGTGTCTTCATTCTTATTGG + Intergenic
1202329168 Y:23728355-23728377 GACTGTGACTTCATTGTTGTGGG - Intergenic
1202541603 Y:25941699-25941721 GACTGTGACTTCATTGTTGTGGG + Intergenic