ID: 935315598 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:101830716-101830738 |
| Sequence | TGGTACCAGGAGACCAGAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 205 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 24, 4: 180} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935315598_935315604 | 14 | Left | 935315598 | 2:101830716-101830738 | CCTGCTCTGGTCTCCTGGTACCA | 0: 1 1: 0 2: 0 3: 24 4: 180 |
||
| Right | 935315604 | 2:101830753-101830775 | CTGAGCGATCACTTAGTGATTGG | 0: 1 1: 0 2: 0 3: 5 4: 69 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935315598 | Original CRISPR | TGGTACCAGGAGACCAGAGC AGG (reversed) | Intronic | ||