ID: 935315599

View in Genome Browser
Species Human (GRCh38)
Location 2:101830729-101830751
Sequence GACTATCACAGGCTGGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315599_935315604 1 Left 935315599 2:101830729-101830751 CCTGGTACCAGCCTGTGATAGTC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315599 Original CRISPR GACTATCACAGGCTGGTACC AGG (reversed) Intronic