ID: 935315604

View in Genome Browser
Species Human (GRCh38)
Location 2:101830753-101830775
Sequence CTGAGCGATCACTTAGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315601_935315604 -10 Left 935315601 2:101830740-101830762 CCTGTGATAGTCCCTGAGCGATC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315597_935315604 15 Left 935315597 2:101830715-101830737 CCCTGCTCTGGTCTCCTGGTACC 0: 1
1: 0
2: 2
3: 20
4: 259
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315600_935315604 -6 Left 935315600 2:101830736-101830758 CCAGCCTGTGATAGTCCCTGAGC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315598_935315604 14 Left 935315598 2:101830716-101830738 CCTGCTCTGGTCTCCTGGTACCA 0: 1
1: 0
2: 0
3: 24
4: 180
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315599_935315604 1 Left 935315599 2:101830729-101830751 CCTGGTACCAGCCTGTGATAGTC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315604 Original CRISPR CTGAGCGATCACTTAGTGAT TGG Intronic
903063165 1:20684251-20684273 CTGAGCGACCCCTGAGTGCTGGG - Intronic
903353609 1:22732804-22732826 ATGACCCATCACTTAGAGATAGG + Intronic
907948613 1:59158930-59158952 ATCAGTGATCACTTAGGGATTGG + Intergenic
908408514 1:63839821-63839843 TTTAGCCATCACTCAGTGATTGG + Intronic
922035801 1:221846725-221846747 CTGAGGGTTCACTGACTGATTGG + Intergenic
1062894922 10:1096046-1096068 CTTAGTGACCACTTAGTGAGAGG - Intronic
1066799103 10:39164247-39164269 CTGAGAAATCACTTTGTGATGGG + Intergenic
1066804779 10:39236056-39236078 CTGAGAAACCACTTTGTGATGGG + Intergenic
1070685368 10:78476619-78476641 CTGGGCGATCACTGAGAGATGGG - Intergenic
1074916814 10:117964700-117964722 CTGAGCGAGCACTGAGTGAGAGG - Intergenic
1077126438 11:940725-940747 CTGAGCTCTCACTTTGTGCTTGG + Intronic
1082302373 11:50523950-50523972 CTGAGAGACCACTTTGTGATAGG + Intergenic
1086168422 11:83807543-83807565 CTGAGCATTCACTTTGTGCTAGG - Intronic
1087438102 11:98148473-98148495 CTGAGTGATCAATGAGTGAGTGG + Intergenic
1094867838 12:34559685-34559707 CTGAGAAACCACTTTGTGATGGG - Intergenic
1098190192 12:67939703-67939725 CTGACCATTAACTTAGTGATAGG - Intergenic
1110739449 13:78977399-78977421 CTAAACCATCACTTAGTCATGGG - Intergenic
1115569858 14:34656249-34656271 CTGAGCTATCACTGAATGAGGGG + Intergenic
1127205807 15:56717090-56717112 CTTAGCATTCCCTTAGTGATTGG - Intronic
1129526962 15:76224465-76224487 CTGAGCCATCACGGAGTAATCGG + Intronic
1136738745 16:32491619-32491641 CTGAGAAACCACTTTGTGATTGG + Intergenic
1136739305 16:32500323-32500345 CTGAGAAATAACTTTGTGATAGG + Intergenic
1136740276 16:32514581-32514603 CTGAGAAACCACTTTGTGATGGG - Intergenic
1136740349 16:32515772-32515794 ATGAGAAATCACTTTGTGATGGG - Intergenic
1139020237 16:62739704-62739726 CTTAGCAATCACATTGTGATTGG - Intergenic
1203013908 16_KI270728v1_random:331469-331491 CTGAGAAATAACTTTGTGATAGG - Intergenic
1203014468 16_KI270728v1_random:340172-340194 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203029265 16_KI270728v1_random:559468-559490 ATGAGAAATCACTTTGTGATGGG + Intergenic
1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG + Intergenic
1203029708 16_KI270728v1_random:565703-565725 CTGAGAAAACACTTTGTGATGGG + Intergenic
1203032243 16_KI270728v1_random:604628-604650 CTGAGAAATAACTTTGTGATAGG - Intergenic
1203032803 16_KI270728v1_random:613331-613353 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203042013 16_KI270728v1_random:768728-768750 CTGAGAAAACACTTTGTGATGGG - Intergenic
1203042381 16_KI270728v1_random:773771-773793 CTGAGAAACCACTTTGTGATGGG - Intergenic
1203042456 16_KI270728v1_random:774963-774985 ATGAGAAATCACTTTGTGATGGG - Intergenic
1153969318 18:10210835-10210857 CTGAGCCATCATTTTGTCATTGG - Intergenic
1158044780 18:53143094-53143116 CTCAGCCACCACTTAGTGAGTGG - Intronic
1165019393 19:32911126-32911148 CTGTGACATCACTAAGTGATAGG + Intronic
931226263 2:60334549-60334571 GTGAGCGCTCAAGTAGTGATGGG - Intergenic
935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG + Intronic
1168798566 20:628947-628969 TTGAGCGCTCACTACGTGATAGG + Intergenic
1173004322 20:39127875-39127897 GTGAGTGCTCACTTAGTGTTTGG + Intergenic
1181610853 22:24010948-24010970 CTGAGCAGTCACTAAATGATGGG - Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
949217734 3:1589947-1589969 CTTAGTGGTCACCTAGTGATTGG - Intergenic
950249652 3:11453783-11453805 CTGAGCAAACCCTCAGTGATGGG + Intronic
954924843 3:54224507-54224529 CTGGGACATCACTAAGTGATAGG + Intronic
960359234 3:116690862-116690884 CTGTGACATCACTAAGTGATAGG + Intronic
961196278 3:125004151-125004173 CTGAGCATTCACTTCATGATAGG - Intronic
965428223 3:168553963-168553985 CTGTGGGATCACTTGGTAATTGG - Intergenic
975182050 4:71357599-71357621 CTAAGCAAACACTTTGTGATAGG - Intronic
977170376 4:93753905-93753927 GTCATGGATCACTTAGTGATGGG + Intronic
978443576 4:108759607-108759629 ATGTGTGATCACTTAGTGAATGG + Intronic
981173521 4:141653037-141653059 CTGAGTGATCACATAGAGACTGG + Intronic
981288913 4:143051268-143051290 CTGAGCGTTTACTGTGTGATAGG - Intergenic
981801539 4:148663343-148663365 CTGAACTATCAATTAATGATGGG + Intergenic
985946846 5:3192003-3192025 CTGAGGAAACAATTAGTGATGGG - Intergenic
989832198 5:45933708-45933730 CTGAGAAACCACTTTGTGATTGG + Intergenic
1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG + Intergenic
1009259206 6:61462543-61462565 CTGAGAAACCACTTTGTGATGGG + Intergenic
1009261787 6:61499982-61500004 CTGAGAAACCACTTGGTGATAGG - Intergenic
1015191120 6:130473470-130473492 CTTAGGCATCACTTAGTGACAGG + Intergenic
1020529259 7:9310055-9310077 CTGAGCTAGGACTTAGTAATGGG - Intergenic
1025550371 7:62239270-62239292 CTGAGAAACCACTTTGTGATTGG + Intergenic
1025550883 7:62247279-62247301 CTGAGAAATAACTTTGTGATAGG + Intergenic
1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG + Intergenic
1028063638 7:86352926-86352948 CTGAGTTATAATTTAGTGATTGG + Intergenic
1029948009 7:104553945-104553967 ATGAGCGATCACTGAGAGAAGGG - Intronic
1034279282 7:149840966-149840988 CTGAGGTTTCACTTAGTGGTTGG - Intronic
1037634484 8:20689125-20689147 CTGATCCACAACTTAGTGATGGG + Intergenic
1054362615 9:64191435-64191457 CTGAGAAACCACTTTGTGATGGG + Intergenic
1055389462 9:75803999-75804021 CTGAGCACTCACTAAGTGCTAGG + Intergenic
1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG + Intergenic
1195444034 X:104930447-104930469 CTGAGTGCTCACTATGTGATAGG + Intronic