ID: 935315604

View in Genome Browser
Species Human (GRCh38)
Location 2:101830753-101830775
Sequence CTGAGCGATCACTTAGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935315599_935315604 1 Left 935315599 2:101830729-101830751 CCTGGTACCAGCCTGTGATAGTC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315601_935315604 -10 Left 935315601 2:101830740-101830762 CCTGTGATAGTCCCTGAGCGATC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315598_935315604 14 Left 935315598 2:101830716-101830738 CCTGCTCTGGTCTCCTGGTACCA 0: 1
1: 0
2: 0
3: 24
4: 180
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315597_935315604 15 Left 935315597 2:101830715-101830737 CCCTGCTCTGGTCTCCTGGTACC 0: 1
1: 0
2: 2
3: 20
4: 259
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
935315600_935315604 -6 Left 935315600 2:101830736-101830758 CCAGCCTGTGATAGTCCCTGAGC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935315604 Original CRISPR CTGAGCGATCACTTAGTGAT TGG Intronic