ID: 935317708

View in Genome Browser
Species Human (GRCh38)
Location 2:101853079-101853101
Sequence ACTTGGGGCCTTATTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935317708_935317710 -10 Left 935317708 2:101853079-101853101 CCAAAGGAAATAAGGCCCCAAGT 0: 1
1: 0
2: 0
3: 8
4: 159
Right 935317710 2:101853092-101853114 GGCCCCAAGTGAAATGATCAGGG 0: 1
1: 0
2: 2
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935317708 Original CRISPR ACTTGGGGCCTTATTTCCTT TGG (reversed) Intronic
902628206 1:17688979-17689001 ACTTGGGGCCTCATCACCTCAGG - Intronic
906557212 1:46723311-46723333 ACTTGGGGTTTAATTTCCTGTGG - Intergenic
908405669 1:63811877-63811899 ACTTTGGGCTCTATGTCCTTAGG + Intronic
910417677 1:87017846-87017868 ATTTGGGGCCTGTTTTCCCTCGG - Intronic
911449185 1:98044009-98044031 ACTGGTGGCATTGTTTCCTTGGG - Intergenic
911516472 1:98873973-98873995 AGTTGTGGCCTGATTACCTTAGG + Intergenic
915206665 1:154275091-154275113 ACTTGTCTCCTTTTTTCCTTTGG + Intronic
916457972 1:164990796-164990818 GCTTGGTTCTTTATTTCCTTAGG - Intergenic
917771971 1:178289372-178289394 CCATGGGACCTTATTTCCTTAGG + Intronic
920298614 1:204975082-204975104 ATTTGGGGCATTATCTGCTTTGG + Intronic
921947105 1:220893871-220893893 ACTTGGGCCCTCTCTTCCTTCGG - Intergenic
922779361 1:228239754-228239776 ACTTTGGTCCTTAATTCCTGGGG + Intronic
1063470423 10:6280259-6280281 ACTTGCCGCCTTATTTTATTTGG + Intergenic
1065937556 10:30534309-30534331 ACTTGGTGCAGTATTTTCTTTGG - Intergenic
1066209067 10:33218698-33218720 ACTTGGGGCTTTAGTGGCTTTGG + Intronic
1067299532 10:44996193-44996215 GCTTTGGGCCTTGTTTCCATGGG - Intergenic
1067920917 10:50456367-50456389 ACATGGTTCCTTATTTCCCTTGG - Intronic
1068549188 10:58386589-58386611 ATTTGGGGCCTTGTTGCCTTTGG + Intronic
1068574395 10:58668211-58668233 AGTTGGTGCATTATTGCCTTGGG + Intronic
1069578143 10:69545131-69545153 CCTTGGGGCCTAAACTCCTTTGG - Intergenic
1072558579 10:96546550-96546572 TCATGTGTCCTTATTTCCTTAGG + Intronic
1074418029 10:113284423-113284445 ATCTTGGGCATTATTTCCTTTGG + Intergenic
1078339923 11:10491300-10491322 AGCTGGGGCTTCATTTCCTTAGG + Intronic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1079424462 11:20326899-20326921 AAGGGAGGCCTTATTTCCTTTGG + Intergenic
1079515213 11:21259347-21259369 AGAAGTGGCCTTATTTCCTTGGG + Intronic
1079597820 11:22272809-22272831 ATTTGTGGCCTCTTTTCCTTTGG + Exonic
1079666269 11:23110121-23110143 ACTGGGCAACTTATTTCCTTAGG - Intergenic
1080392367 11:31860350-31860372 ACTTGGGACTTTAATTCATTAGG + Intronic
1081419424 11:42855848-42855870 ATTTAGGGCCTTACTTCATTTGG - Intergenic
1084054396 11:66622912-66622934 GCTTAGAGCCTTATTTCCTAGGG + Intronic
1084751142 11:71205065-71205087 ACTTGGGGCCTTCCTGCCTCTGG - Intronic
1085439355 11:76544237-76544259 ACTTTGTGCCTTTTTTACTTAGG + Exonic
1087232040 11:95676730-95676752 ACTTGGGGCCTAATTTAGATAGG + Intergenic
1087690894 11:101319792-101319814 CCCTGGTGCCTTATTTCATTTGG + Intergenic
1087867713 11:103252338-103252360 AGGTGGTGACTTATTTCCTTTGG + Intronic
1090236556 11:125152489-125152511 ACTCGGGGCCTCACCTCCTTCGG + Intergenic
1090690256 11:129173870-129173892 ACTTGAGGTCTTATTCACTTGGG + Intronic
1092905252 12:13095392-13095414 ACTTGGGCCCTTAGATCATTAGG + Intronic
1093299314 12:17434609-17434631 AATTGAGGCTTTATATCCTTTGG + Intergenic
1094660286 12:32463702-32463724 ACTTGGAGCCTAAGTTTCTTGGG - Intronic
1096339614 12:50786565-50786587 ACTTGGACCTTTTTTTCCTTTGG + Intronic
1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG + Intergenic
1098636425 12:72789768-72789790 CCTTGGGGCCTAAATTCCTGGGG - Intergenic
1100450711 12:94703156-94703178 ACATGAAGCCTTATTTACTTAGG + Intergenic
1104389534 12:128379754-128379776 AAATGTGGCGTTATTTCCTTGGG - Intronic
1106869425 13:34002805-34002827 CATTGGGGTCTTATTTCTTTAGG - Intergenic
1107630211 13:42335016-42335038 ACTGGGGGCCTTCTGCCCTTGGG - Intergenic
1109496077 13:63173782-63173804 ATGTGTTGCCTTATTTCCTTGGG - Intergenic
1112029474 13:95443867-95443889 ACTTGGGGCCTTGCTGACTTGGG - Intronic
1112342556 13:98564738-98564760 ACTTGGAACCTTATTTCATAAGG - Intronic
1112798744 13:103087362-103087384 ACTTGAGGCTCTATTTTCTTTGG - Intergenic
1112863686 13:103867325-103867347 AATTGTGGACTTATTTCTTTAGG + Intergenic
1120316808 14:82904765-82904787 ACTTTAGGCCTCATCTCCTTTGG + Intergenic
1120463980 14:84832456-84832478 ACTTGTTTCCTTATTGCCTTTGG - Intergenic
1121874227 14:97436448-97436470 ACTTGTGGTCTTAGTTACTTGGG + Intergenic
1121881015 14:97500218-97500240 TGTTGGGGCCTAATCTCCTTGGG - Intergenic
1123935593 15:25192544-25192566 ACATGGTGACTTCTTTCCTTTGG - Intergenic
1127613128 15:60656746-60656768 ACTCAGGGCCTTATTTGATTTGG - Intronic
1130043706 15:80427904-80427926 ACATCTGGCCTTGTTTCCTTTGG + Intronic
1132675386 16:1119242-1119264 AATTGGGGCCCTCTTTCCTGGGG + Intergenic
1132839455 16:1971981-1972003 ACTTGGCGCCATCTTTGCTTCGG - Intergenic
1133960685 16:10490393-10490415 ACTTGGGTGATTAATTCCTTGGG - Intergenic
1134244131 16:12527384-12527406 CTTTGGGGGTTTATTTCCTTAGG - Intronic
1134514608 16:14876576-14876598 ACTGGGGCCCACATTTCCTTGGG + Intronic
1134702285 16:16275229-16275251 ACTGGGGCCCACATTTCCTTGGG + Intronic
1134969545 16:18519421-18519443 ACTGGGGCCCACATTTCCTTGGG - Intronic
1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG + Intergenic
1140680108 16:77376408-77376430 ACTTGGGGCCTGATATGGTTTGG - Intronic
1142004258 16:87681793-87681815 GCTTGGAGCCTGCTTTCCTTTGG + Intronic
1143798149 17:9355201-9355223 ATTTCTGGCATTATTTCCTTTGG + Intronic
1144166477 17:12616298-12616320 ACTTGGGGCTTTATCTTCTCAGG - Intergenic
1145783631 17:27580141-27580163 ACTTTGGGGCTTGTTTCCTTTGG + Intronic
1150063082 17:62085540-62085562 ACTTTGGGCCATCTCTCCTTGGG - Intergenic
1150964360 17:69950917-69950939 ACTTGGTGTCTTTTTCCCTTGGG - Intergenic
1151093568 17:71470448-71470470 TCTTGGGGCCTTGAGTCCTTTGG - Intergenic
1154060759 18:11057339-11057361 AGTTGGGGCCTTATCTACTGAGG + Intronic
1156865742 18:41887088-41887110 GCTTAGGGACTTATTTTCTTTGG - Intergenic
1157885976 18:51366968-51366990 CCTTTGGGCCCTGTTTCCTTCGG + Intergenic
1158039076 18:53070542-53070564 ACTTGGGCCCTGATTTGTTTAGG + Intronic
1164598024 19:29542867-29542889 ACTTGGAGACTTTTTTCCTATGG - Intronic
1165655222 19:37526805-37526827 ACTTCGGTGCTTCTTTCCTTCGG + Intronic
1167622361 19:50567217-50567239 CTTTGGGGCCTTCTATCCTTGGG - Intronic
1167911940 19:52710915-52710937 ACTTGGGGGATTATGTCCTGAGG + Intronic
926369834 2:12168645-12168667 CCCTGTGGCCTTCTTTCCTTCGG - Intergenic
932311987 2:70750180-70750202 ACTTGGAGCATTGTTTCCTAAGG - Intronic
935013136 2:99154748-99154770 AACTGGGGCCTTATGACCTTCGG + Exonic
935317708 2:101853079-101853101 ACTTGGGGCCTTATTTCCTTTGG - Intronic
935702502 2:105824714-105824736 ACTTCCGGCCTTGGTTCCTTTGG + Intronic
935839083 2:107089080-107089102 ACTTGGTGCTTCATGTCCTTGGG + Intergenic
937272514 2:120662002-120662024 ACTGGGGTCTTTATTTCCTTGGG + Intergenic
938764746 2:134453316-134453338 TCTTGCAGCCTTGTTTCCTTGGG - Exonic
942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG + Intergenic
944206788 2:197164934-197164956 ACTTGGAGCCATATAACCTTAGG + Intronic
945759071 2:213889401-213889423 ACTTGTGGTTATATTTCCTTGGG + Intronic
946707675 2:222474847-222474869 ATTTGTTGCCTAATTTCCTTTGG + Intronic
946990549 2:225324635-225324657 GCCTGAGGCCTTATTTCATTGGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1177038312 21:16072869-16072891 ACTGGGGGCCTTCTTTCAGTAGG + Intergenic
1179620500 21:42612433-42612455 ATTTGGGGCAATTTTTCCTTGGG - Intergenic
1185115116 22:48929529-48929551 AGTTGCTGCATTATTTCCTTAGG + Intergenic
950931465 3:16793173-16793195 TCTTGGGGGCTTATTTCCTCTGG - Intergenic
952250046 3:31644392-31644414 ATTTGGGGCCATTTTCCCTTGGG - Intergenic
953144591 3:40262712-40262734 ATTTAGGGCCTCATTTTCTTGGG - Intergenic
956054707 3:65286594-65286616 TCTTGGTGCCATATTCCCTTCGG - Intergenic
956835118 3:73090163-73090185 ACTTGGGGCCGTAGATCCTGAGG - Intergenic
957290525 3:78272185-78272207 ACTTGGGCCTTTTTTTCCTCTGG + Intergenic
960683376 3:120272692-120272714 ACTTTGGGTTTTATTTCCATAGG - Intronic
963292979 3:143512303-143512325 ACTTGTTACATTATTTCCTTAGG - Intronic
964157274 3:153601465-153601487 ACTTGTTGACTTATTTCCTTAGG - Intergenic
966354727 3:179067923-179067945 TCTTTGGGACTTCTTTCCTTTGG + Intronic
967050663 3:185781121-185781143 TTTTGCAGCCTTATTTCCTTGGG - Intronic
967766319 3:193283747-193283769 ACTTAGCCTCTTATTTCCTTAGG - Intronic
967991181 3:195132039-195132061 ACTGGGTTCCTTAGTTCCTTAGG - Intronic
968846100 4:3042298-3042320 ACTTGGGGTCTTTATTCTTTGGG + Intergenic
968928903 4:3565736-3565758 ACCTGGGGCTTTCTTTCCTCAGG + Intergenic
969209536 4:5676258-5676280 TCTTGGGGCCTCATTTTCCTTGG + Intronic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
971092615 4:23362256-23362278 TCTTGGTGCCTTGTTTCCTCAGG - Intergenic
971458467 4:26867977-26867999 ATTTTTGGCTTTATTTCCTTTGG + Intronic
975162666 4:71141668-71141690 AATTTGGGACTTATTTCCATGGG - Intergenic
975696792 4:77021646-77021668 ACTGAGGGCCATAGTTCCTTGGG + Intronic
978742424 4:112152191-112152213 ACTGGGGGCCTTTTGTCCATAGG + Intronic
980591360 4:134893711-134893733 CCTTAGGGTGTTATTTCCTTAGG - Intergenic
980778797 4:137469822-137469844 ATTTGGAGCATAATTTCCTTTGG - Intergenic
987045277 5:14101956-14101978 ACTTGGTTCTTCATTTCCTTTGG - Intergenic
992271450 5:75068182-75068204 ACTTGTATCCTCATTTCCTTAGG + Intergenic
996409551 5:123143444-123143466 ACTAGGTGCCTTCTTTTCTTTGG + Intronic
996901056 5:128541908-128541930 ACTTGTGGCCATTTTTCCTCAGG + Intronic
997423113 5:133784993-133785015 CCTTATGGCCTTATTCCCTTGGG - Intergenic
998407149 5:141880364-141880386 AATTGGGGCCTTTTTTCCCCAGG + Intergenic
1000766838 5:165302134-165302156 ACATGAGGCCTTCTTGCCTTTGG - Intergenic
1003031242 6:2603342-2603364 ACCTCCGGGCTTATTTCCTTGGG - Intergenic
1003209078 6:4043381-4043403 CCTTGGGGCCATATGTGCTTTGG + Intronic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1007105982 6:39283207-39283229 ACTGAGGTCCTTATTTCCTCAGG + Intergenic
1008355576 6:50548527-50548549 ACTTGGTGCCAAATTTCCTATGG - Intergenic
1010025397 6:71209834-71209856 ACCTGGTGCTTTATGTCCTTTGG + Intergenic
1010574179 6:77511557-77511579 CCTTGGGGGATTATTCCCTTTGG + Intergenic
1012974838 6:105769185-105769207 ACTTGTGCCCTTTCTTCCTTGGG + Intergenic
1017456775 6:154607723-154607745 CCTTGGGGCCTCCTTTCTTTAGG + Intergenic
1019777094 7:2918337-2918359 ACTTGGTTCCTTGGTTCCTTAGG - Intronic
1020966740 7:14879572-14879594 ACTTGGGGCTTCATAGCCTTAGG - Intronic
1021937409 7:25644875-25644897 ACCTGAGACCTTGTTTCCTTTGG - Intergenic
1028351152 7:89850651-89850673 ACTTGTGGTCATATTTACTTGGG - Intergenic
1046281589 8:112040315-112040337 ACTTAGTTCCTTATTTCCTATGG - Intergenic
1049983088 9:922678-922700 AAATGGTGCCTTATTTCTTTTGG + Intronic
1050410765 9:5362880-5362902 ACTTGTGGCCTTGCTTCCTGCGG + Intronic
1052201699 9:25789883-25789905 ACTTGGCCCCTTCTATCCTTGGG + Intergenic
1052279068 9:26712452-26712474 TCCTGGTGCCTTATTTCTTTGGG + Intergenic
1052603802 9:30672318-30672340 ACTTGCGGCCTTGTGTCCCTGGG + Intergenic
1052672912 9:31581076-31581098 CCCTGGGACCCTATTTCCTTGGG - Intergenic
1053760936 9:41349713-41349735 ACTTGGGGCCTAATGTTCATCGG - Intergenic
1054141656 9:61535803-61535825 ACCTGGGGCTTTCTTTCCTCAGG - Intergenic
1054191912 9:61990712-61990734 ACCTGGGGCTTTCTTTCCTCAGG + Intergenic
1054461356 9:65466526-65466548 ACCTGGGGCTTTCTTTCCTCAGG - Intergenic
1054646468 9:67597078-67597100 ACCTGGGGCTTTCTTTCCTCAGG - Intergenic
1059621297 9:116008517-116008539 ACCTGTGGCCTGATTTTCTTGGG + Intergenic
1062445805 9:136593759-136593781 AGTTGGGGCCTCATTTCCTCTGG - Intergenic
1188838542 X:34987694-34987716 ACTTGGGAGGTTATTTCATTAGG + Intergenic
1192033201 X:67536789-67536811 ACTTGGGGTCAAATATCCTTAGG + Intergenic
1193882021 X:86935428-86935450 ACTTGGCACCTTAATTCCTTGGG + Intergenic
1197148481 X:123193901-123193923 ATTTGGTGCCTCACTTCCTTGGG - Intronic
1198034101 X:132783811-132783833 AGATGAGGCCTTATTTGCTTGGG + Intronic
1199248857 X:145637187-145637209 ACTTGGAGCCTTACATACTTGGG + Intergenic
1199316208 X:146380496-146380518 CCCTGGTGCCTTATTTCATTCGG - Intergenic
1200038865 X:153351303-153351325 ACTTGGGGGTGGATTTCCTTGGG + Exonic
1200096805 X:153668447-153668469 ACGTGGGGCCTTGTTGCCTGTGG - Intergenic