ID: 935319641

View in Genome Browser
Species Human (GRCh38)
Location 2:101873435-101873457
Sequence ACGGCTCCTGCAGTGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935319641 Original CRISPR ACGGCTCCTGCAGTGGTTCC AGG Intronic
900130617 1:1085623-1085645 AGGGCTCCAGCAGAGGTTCTGGG + Intronic
900181737 1:1314096-1314118 GCGGCTCTTGTAGGGGTTCCTGG - Intronic
904756489 1:32771241-32771263 GCCGCCCCTGCTGTGGTTCCTGG + Exonic
905339723 1:37270247-37270269 ACAGTTCCTGCAGTGGGTCTGGG - Intergenic
905799883 1:40836599-40836621 TTGGATCCTGCAGTGTTTCCAGG + Intronic
908252053 1:62273381-62273403 ACTGCTCCTGCAGGAGCTCCTGG + Exonic
916505270 1:165422983-165423005 TCTGCTCCTGCAGGGGCTCCTGG - Intronic
920502054 1:206491672-206491694 AAGACTCCTGCAGGTGTTCCAGG + Exonic
923449340 1:234102010-234102032 TGTGCTCCTGCAGTGGTACCTGG - Intronic
924085915 1:240451491-240451513 TCTGCCCCTGCAGTGGTTCTGGG + Intronic
1067150451 10:43728485-43728507 ACGGCTGCTGCAGCGCCTCCTGG + Intergenic
1069720231 10:70545054-70545076 CCGGCACCTGGAGTGGTGCCTGG - Intronic
1075275021 10:121085549-121085571 AGGCCTACTGGAGTGGTTCCTGG + Intergenic
1075635432 10:124027245-124027267 ACCGCTCCTCCAGGGGTCCCAGG - Intronic
1077384034 11:2260646-2260668 ACAGCCCCTGCTGTGGTGCCAGG - Intergenic
1079679635 11:23278879-23278901 ACAGCTTCTGCATTTGTTCCTGG - Intergenic
1080639881 11:34152440-34152462 GCAGGTCCTGCAGTGGATCCAGG + Exonic
1081726548 11:45333829-45333851 AAGCCTCCTGCAGGGCTTCCGGG - Intergenic
1088807629 11:113366782-113366804 ACGGCACATGCAGTGGCTGCAGG - Intronic
1089772272 11:120812107-120812129 ACGTCTACTGCCATGGTTCCAGG - Intronic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1096564078 12:52461635-52461657 TATGCTTCTGCAGTGGTTCCTGG - Intergenic
1096609908 12:52794325-52794347 ACCGCACCTGCAATGGTTGCAGG + Exonic
1101375537 12:104168156-104168178 TCGGCTCCTGCTGTGCTTCTCGG - Intergenic
1102445665 12:113000431-113000453 CCGCCTTATGCAGTGGTTCCTGG - Intronic
1104308174 12:127629232-127629254 ACGGTTTCTGCAGTGTTCCCTGG + Intergenic
1111359372 13:87154830-87154852 ACTACTCATGCAGTGGTTCTAGG - Intergenic
1112548500 13:100396159-100396181 ACCACTGCTGCAGTGGTTCAGGG - Intronic
1113727593 13:112616756-112616778 ACGTCCCCTGCAGAGGTGCCAGG - Intergenic
1122207843 14:100157045-100157067 AAGCCTCCTGGATTGGTTCCAGG + Intronic
1122563079 14:102630996-102631018 ATGGCTTATGCAGTGGTTCAGGG + Intronic
1129787857 15:78321181-78321203 CCAGCTCCTGCAGTGGTCTCAGG + Intergenic
1131987927 15:98063984-98064006 AGCCCTTCTGCAGTGGTTCCTGG + Intergenic
1132419435 15:101652600-101652622 AGGTCTCCTGCAGTGGAACCAGG - Intergenic
1132676536 16:1123516-1123538 AAGGCTCCTGCAGAGGGTCCAGG - Intergenic
1132819930 16:1859911-1859933 CCGGCTCCTGCTGAGGCTCCAGG + Intronic
1132858982 16:2060792-2060814 ACGGCTCCTTCAGCAGCTCCAGG + Exonic
1135198721 16:20418223-20418245 ACGGCTCCCGGAGTGGTGGCTGG + Exonic
1135741596 16:24980127-24980149 CCTGCTCTTGCATTGGTTCCCGG - Intronic
1138839025 16:60475164-60475186 ATGCATCCTTCAGTGGTTCCTGG + Intergenic
1139388249 16:66588363-66588385 AAGGCTCCTGAAGTGCTCCCAGG + Intergenic
1139851225 16:69952408-69952430 CCGGCTCCTCCTGTGGCTCCTGG - Intronic
1139880205 16:70175320-70175342 CCGGCTCCTCCTGTGGCTCCTGG - Intronic
1140372304 16:74420197-74420219 CCGGCTCCTCCTGTGGCTCCTGG + Intronic
1143103395 17:4515965-4515987 ATGGCTCCTGCAGGGGGTCCAGG - Intronic
1143382119 17:6503095-6503117 ATGGCACCGTCAGTGGTTCCTGG + Intronic
1143450937 17:7036335-7036357 CCGGCTCCTGCAGAGGCTCTGGG + Exonic
1151385647 17:73753719-73753741 ACAGGTTCTGCGGTGGTTCCAGG - Intergenic
1151434876 17:74089070-74089092 ACAGCTCCTGCAGTGGTCCAGGG - Intergenic
1152555305 17:81050045-81050067 TGGGCTCCTCCCGTGGTTCCTGG + Intronic
1156451822 18:37270881-37270903 ACGGCTGGTGCAGTGATGCCCGG + Exonic
1165023879 19:32945402-32945424 GCAGCTCCTGCAGTGATGCCTGG - Intronic
1165064630 19:33221761-33221783 CCGGCTCCTGCAGGGGTTTGTGG - Intronic
1165327999 19:35125324-35125346 CCAGCTCCTGCAGTGGCTCCAGG + Exonic
1165953098 19:39485720-39485742 ACGGTTCCTGCAGAGGGTCTGGG - Exonic
926707209 2:15845384-15845406 ACAGCTCCAGCAGTGCTTACAGG + Intergenic
927063703 2:19448267-19448289 ACGCCTTCTCTAGTGGTTCCAGG + Intergenic
927736320 2:25525847-25525869 ACCCCTCCTTCAGAGGTTCCAGG - Intronic
927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG + Intronic
928622076 2:33100200-33100222 ACAGCTCATGCTGTGGTTCATGG + Intronic
933474399 2:82770885-82770907 TAGGTTCCTGCAGTGGTTCTTGG - Intergenic
934046225 2:88174778-88174800 ACAGTTCCTGCAGTACTTCCTGG + Exonic
935319641 2:101873435-101873457 ACGGCTCCTGCAGTGGTTCCAGG + Intronic
935538394 2:104321374-104321396 GCGGCTCCAGCCCTGGTTCCTGG - Intergenic
938194931 2:129319020-129319042 CCGCCTCCTGCTGTGGTTCATGG + Intergenic
938237294 2:129716801-129716823 TGGCCTCCTCCAGTGGTTCCAGG - Intergenic
941160703 2:162031257-162031279 ACAGAACCTGGAGTGGTTCCAGG - Intronic
941548870 2:166889405-166889427 AGGGCTGCTGCAGTGGAGCCAGG + Intronic
944263737 2:197701663-197701685 TATGCTCCTGCAGTGGTTGCTGG + Intronic
946429297 2:219616118-219616140 ACAGCTCCTCCCATGGTTCCCGG - Exonic
947736147 2:232456515-232456537 CCGGGACCTTCAGTGGTTCCAGG + Intronic
1168885158 20:1245718-1245740 ACAGCTCCAGCAGTGGTGGCAGG + Intronic
1172793014 20:37519208-37519230 TCGGTTCCTGCAGCGGTGCCCGG - Exonic
1176020241 20:62958998-62959020 CCAGCTCCTGCAGTGGGACCTGG - Intronic
1176078714 20:63261001-63261023 ACGGCCTCTGCAGGGCTTCCTGG + Intronic
1176173588 20:63707537-63707559 CCGGCGCCTGCAGGGGCTCCTGG - Intronic
1182122882 22:27798494-27798516 TCGGCTCCTGCAGAGGGCCCCGG + Exonic
1182444130 22:30380383-30380405 ACAGCTGCTGCAGGGGTTTCTGG + Exonic
1183877687 22:40797941-40797963 ACAGCCCTTGCAGAGGTTCCAGG - Intronic
1185271362 22:49930643-49930665 AGGACTCCTGCTGTGGTTCTGGG - Intergenic
950550337 3:13662382-13662404 AAAGTTGCTGCAGTGGTTCCAGG + Intergenic
953470680 3:43163509-43163531 CCTGCTCCTGCACTGTTTCCTGG - Intergenic
953753206 3:45625095-45625117 TGGCCCCCTGCAGTGGTTCCAGG - Intronic
954304272 3:49717268-49717290 AAGGCTCCTCAAGAGGTTCCTGG - Exonic
957014609 3:75048304-75048326 ACGGCTCCTTCTGTGTTTCATGG - Intergenic
961741708 3:129037090-129037112 GCAGCTCCTGCAGAGGCTCCGGG + Exonic
962191798 3:133318836-133318858 TATGCTCCTGCAGTGGTTCCTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
965866853 3:173215308-173215330 TATGCTCCTGCAGTGGTTCCTGG + Intergenic
968046015 3:195624266-195624288 ACACCACCTGCAGTGGTCCCTGG - Intergenic
968278173 3:197456703-197456725 CGGGCTGCTGCAGCGGTTCCGGG - Intergenic
968308639 3:197665821-197665843 ACACCACCTGCAGTGGTCCCTGG + Intergenic
968704637 4:2072233-2072255 AGGCCTCCTGCAGTGGCACCAGG + Exonic
969443072 4:7228677-7228699 GCGGGTCCTGAAGTGGATCCAGG - Intronic
976266595 4:83190998-83191020 AATGCTCCTGCAGTGGCTCTTGG - Intergenic
985544843 5:504426-504448 ACGGCCCCTGCAGCGGCTCAAGG - Intronic
985747300 5:1654609-1654631 ACACCACCTGCAGTGGTCCCTGG + Intergenic
988310874 5:29556019-29556041 AGAGCAGCTGCAGTGGTTCCAGG + Intergenic
989025671 5:37064699-37064721 CAGGCTCCTACAGTGGCTCCTGG + Exonic
991057425 5:62335108-62335130 ACTGCTCCTGCTGTGGCTCAAGG + Intronic
992689350 5:79227976-79227998 ACGTCTCCTAAAGTGGTGCCAGG + Intronic
993033501 5:82731148-82731170 ACTGCTGCTGCTGTGGTACCTGG - Intergenic
997229822 5:132234221-132234243 CCAGCTGCTGCAGTGGTTCCAGG - Intronic
1003476743 6:6490615-6490637 ACGCTTCCTCCAGTGGCTCCAGG - Intergenic
1003608365 6:7585778-7585800 CCGGGTCCCGCAGTGGGTCCCGG + Exonic
1008290233 6:49705954-49705976 CATGCTCCTGCAGTGGTTCTTGG + Intronic
1014068704 6:117156498-117156520 CCGGTGCCTGCAATGGTTCCTGG + Intergenic
1014278697 6:119417248-119417270 TATGCTCCTGCAGTGGTTCTTGG + Intergenic
1016425748 6:143934276-143934298 TATGCTCCTGCAGTTGTTCCTGG + Intronic
1017515999 6:155156279-155156301 GAGGCTTCTGCAGTGGTACCGGG - Intronic
1022558315 7:31323517-31323539 ACTGCTCCTGCAGTCATTCTGGG + Intergenic
1024309487 7:47956349-47956371 CTGGCACCTGCAGTGCTTCCAGG - Intronic
1032215200 7:129952416-129952438 AGGGCCCTTGCAGTGGTTCCGGG + Intronic
1034957811 7:155345454-155345476 TCCGCCCCTTCAGTGGTTCCAGG + Intergenic
1036106099 8:5842132-5842154 CTGGCTACTGCAGTGGTCCCAGG + Intergenic
1038720128 8:30027759-30027781 ACGGCTCCAGCCGTGGTTAACGG + Intergenic
1042151115 8:65785475-65785497 AAGCCTCCTGCAGTGTTTCATGG + Intronic
1045250866 8:100482672-100482694 ATGGCTCCTCCAGTGGTTTCTGG - Intergenic
1046033874 8:108817478-108817500 TATGCTCCTGCAGTGGTTCCTGG + Intergenic
1048863183 8:138739013-138739035 AAGGCTACTGCAGTGGTTCTGGG - Intronic
1049279796 8:141738428-141738450 ACGGCTCATTCCGTGGCTCCTGG - Intergenic
1049446251 8:142632883-142632905 AAGGCTGCTGCTGTGGTTGCGGG + Intergenic
1050854381 9:10333278-10333300 AAGGCTCCTGTGGTTGTTCCTGG - Intronic
1051085766 9:13347205-13347227 AAAGTTCCTGCAGTGCTTCCAGG - Intergenic
1056773841 9:89497769-89497791 GAGGCTCCTGCAGGGGTTCGGGG + Intronic
1058147216 9:101425452-101425474 ACTGTTCCTGCAGCTGTTCCTGG - Exonic
1060402051 9:123354951-123354973 ATGGCTCCTGCTGTCTTTCCAGG + Intergenic
1060782475 9:126422956-126422978 CTGGCTCCTGCAGTGGAGCCAGG - Intronic
1061377869 9:130236742-130236764 CCTGTTCCTGCAGTGGCTCCCGG + Exonic
1061411905 9:130426277-130426299 AGGGTTCCAACAGTGGTTCCTGG - Intronic
1061672180 9:132194860-132194882 GCGGCTGCTGCAGTGGCACCTGG + Intronic
1062266920 9:135690756-135690778 GCTGTCCCTGCAGTGGTTCCCGG - Intergenic
1062388655 9:136325321-136325343 TGGGCCCCTGCAGTGGGTCCTGG - Intergenic
1062555996 9:137113736-137113758 AGGCCTCAGGCAGTGGTTCCAGG - Intronic
1203780814 EBV:99803-99825 ACGGATGCTGCAGAGGTTCAGGG + Intergenic
1199607088 X:149586064-149586086 ACTGCCCCTGCAGTGGACCCTGG - Intronic
1199632034 X:149783304-149783326 ACTGCCCCTGCAGTGGACCCTGG + Intronic