ID: 935319940

View in Genome Browser
Species Human (GRCh38)
Location 2:101876729-101876751
Sequence TGGATTATTAAGGAAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935319940 Original CRISPR TGGATTATTAAGGAAATTGA TGG Intronic
901235207 1:7664001-7664023 TGGGTTATTAAGGAAACAGTCGG - Exonic
903806903 1:26012094-26012116 TGGCTTATTAAAGCAATTTAAGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
907519586 1:55014365-55014387 TTTATTAATAAGGAAATTGAGGG - Intergenic
908005485 1:59723420-59723442 TGAATAATTAAGTAAATGGATGG - Intronic
908884812 1:68776579-68776601 TGCAGTAATAATGAAATTGATGG - Intergenic
909260489 1:73482596-73482618 TGGATTACTGATTAAATTGACGG + Intergenic
910611610 1:89149574-89149596 TGAATGATTTAGGAAATTTAGGG + Intronic
910707434 1:90144829-90144851 TAGATTATTCAAGACATTGAAGG - Intergenic
910742019 1:90529880-90529902 GGGATTCTAAAGTAAATTGATGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
913053637 1:115138370-115138392 TGGAGGATAAAGGAAATAGAGGG - Intergenic
915599990 1:156916117-156916139 AGAATTTTTAAAGAAATTGAAGG + Exonic
916320731 1:163500800-163500822 TGAATTATTAACAAAATTAAAGG - Intergenic
916461154 1:165026143-165026165 TGGATAATTCAGGATAATGAGGG - Intergenic
917297158 1:173532494-173532516 GTAATTGTTAAGGAAATTGAAGG + Intronic
917392092 1:174548659-174548681 TGAATAATTAAGCAAAATGAGGG - Intronic
918997179 1:191776833-191776855 TGGGTTATTAAGGAAATTAAGGG + Intergenic
919058467 1:192600448-192600470 TGGATTATAAATAAACTTGAGGG - Intergenic
919173204 1:193984782-193984804 AGGGTTATTAAAGAAATTGCTGG - Intergenic
920003902 1:202818619-202818641 TGGAGTATTAAGGAGAAAGAAGG + Intergenic
920120460 1:203652536-203652558 TTTATTATTAAATAAATTGAAGG + Intronic
920449140 1:206045056-206045078 TGGATTATTGAATAAATTTAGGG - Intronic
920966653 1:210706695-210706717 TGCATTACTAAGTAAATAGAAGG + Intronic
921341190 1:214136171-214136193 TGGGTTAATAAGGATTTTGAGGG + Intergenic
921487839 1:215735435-215735457 TTGATTATTACAGAAAGTGATGG + Intronic
921580031 1:216885622-216885644 TTGATGAATAAGGAAATAGATGG - Intronic
921807304 1:219470913-219470935 TGGCATATTTAGGAAATCGAGGG - Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924651504 1:245932219-245932241 TGGACTATGAAGCAAATTAACGG + Intronic
1063866792 10:10373861-10373883 TGGAGCATGAAGGAAAGTGAGGG + Intergenic
1064257754 10:13758695-13758717 TGGATTATTAAGCGAAAAGAAGG - Intronic
1064882267 10:20069316-20069338 TGGAATATTAGGCAAAGTGAAGG + Intronic
1068191293 10:53656120-53656142 TGGATTTTAAATGAAATTGTTGG - Intergenic
1068462075 10:57341877-57341899 TGGGTAATTCTGGAAATTGAAGG - Intergenic
1068972662 10:62975731-62975753 TGAATTATTAGAGAAATGGAAGG + Intergenic
1069013249 10:63398434-63398456 TGGAGTATTAATCAAATTCAAGG + Intronic
1069538184 10:69271337-69271359 AGGATTATAAGGGAAATTAATGG + Intronic
1070602374 10:77875022-77875044 TGGGTTGTTATGGAAATTAATGG - Intronic
1072156060 10:92724767-92724789 TCAAATATCAAGGAAATTGAAGG - Intergenic
1072472714 10:95728323-95728345 AAGATTATTAAGAAAATTGTAGG + Intronic
1072766802 10:98101243-98101265 TGGATTTTTAAGAAAATTATTGG - Intergenic
1073181706 10:101587591-101587613 TGGAGTATTACGGGAAATGAGGG + Intronic
1073835491 10:107436355-107436377 AGGATTATTAAGGGGAATGAGGG + Intergenic
1074268021 10:111924955-111924977 TGGATCAGTAAGGAAATAAATGG + Intergenic
1074645558 10:115448425-115448447 TGGATAAATAATGAAATTAAGGG + Intronic
1074693862 10:116030279-116030301 TGGAATCTTCAGGAAATAGATGG - Intergenic
1076341412 10:129748849-129748871 TGAATAATTAAGTAAATGGATGG - Intronic
1078008612 11:7551995-7552017 TGGAGGACTAAGGAAATGGAAGG - Intronic
1078135933 11:8651668-8651690 TGGATGATTAGGAAAACTGATGG + Intronic
1078155262 11:8794564-8794586 TGGACTATGAAGGAAAATGAAGG + Intronic
1078496363 11:11821546-11821568 TGGATTATGAAGAAAAATCAAGG + Intergenic
1082776604 11:57249771-57249793 TGTTTTATTAAGGAAAATTATGG + Intergenic
1082854327 11:57792913-57792935 TGGAGGATCAAGGAATTTGAGGG + Intronic
1084454340 11:69259013-69259035 TGGGTTAGTAAGGAAATTCTGGG + Intergenic
1086453872 11:86942861-86942883 TGCATTGTGAAGGAAAATGAAGG + Intronic
1086933000 11:92713698-92713720 TGCATTTTTCAGAAAATTGAAGG + Intronic
1088050385 11:105507208-105507230 TGGATTATTCAATAAATAGAAGG - Intergenic
1088846851 11:113675452-113675474 GGGCTTATTAAGGAAAATCAGGG - Intergenic
1093167360 12:15819984-15820006 TGGATCTTTCAGGAAATTGGAGG - Intronic
1093240944 12:16672966-16672988 TGAAATATAAAGGTAATTGAAGG - Intergenic
1093316134 12:17652579-17652601 TGAATGATTAATGAAATAGAAGG - Intergenic
1093595170 12:20950713-20950735 TGGGTGATTTTGGAAATTGAAGG - Intergenic
1094070629 12:26409080-26409102 TGGATAATGATGGAAAATGAGGG + Intronic
1095150449 12:38788746-38788768 TTGATAATTCAGTAAATTGAAGG + Intronic
1095334569 12:41010156-41010178 TGGGTGATTCTGGAAATTGAAGG - Intronic
1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG + Intergenic
1096417011 12:51423440-51423462 AGGATTAGTAAAGAGATTGATGG + Intronic
1096572798 12:52533416-52533438 TATATTAATAAGGAAATTTAGGG - Intergenic
1097747242 12:63315092-63315114 TGGGTAATTCTGGAAATTGAAGG - Intergenic
1097895443 12:64820463-64820485 TGGATTGCTAAAGAAAATGAAGG - Intronic
1098348111 12:69527220-69527242 GGGATTATTAAGGGCATTAAGGG - Intronic
1098658513 12:73064295-73064317 GTGATTACTATGGAAATTGAAGG + Intergenic
1099318474 12:81114586-81114608 TTGTTTATTTAGGAAATTTAAGG - Intronic
1099552847 12:84070277-84070299 TGTTTTATAAAGGAAATTAATGG + Intergenic
1099602769 12:84762148-84762170 TTTATTATTAAAGAAATTTAAGG - Intergenic
1099810269 12:87572181-87572203 TGCATTAAAAGGGAAATTGAGGG - Intergenic
1101823806 12:108204715-108204737 TGTCTTATGAAGGAAATTCAAGG + Intronic
1106791192 13:33156192-33156214 TGGGTTTTCCAGGAAATTGATGG - Intronic
1107102059 13:36604234-36604256 TAGATTCTTAAGGAGAGTGAAGG - Intergenic
1108149331 13:47515765-47515787 TGTATCAATAAGAAAATTGAAGG + Intergenic
1112152769 13:96782241-96782263 TGAATTATTTAAGAAACTGAAGG + Intronic
1112295589 13:98183959-98183981 TGGATTAACAAGGAAAGTGAGGG - Intronic
1112303885 13:98255728-98255750 TGTTTTATTAAGAAAGTTGAAGG - Intronic
1113180200 13:107616355-107616377 TGGATTATTATGCAATGTGATGG - Intronic
1113868715 13:113545459-113545481 TAGCTCATTAAAGAAATTGAAGG + Intronic
1114690628 14:24576539-24576561 TGGAGTATTCTGGAATTTGATGG - Intergenic
1114879479 14:26766287-26766309 AGGATTGTGAAGGAAATTAAAGG - Intergenic
1114890592 14:26917395-26917417 AAGATTATTAAGGGAAGTGAAGG + Intergenic
1115037226 14:28872477-28872499 TGCAGAATAAAGGAAATTGAGGG + Intergenic
1117030781 14:51667718-51667740 TGTAATATTAAGGATATTTAAGG + Intronic
1117941346 14:60969303-60969325 TAGTTTCTTAAGGAAATTAAGGG + Exonic
1118032980 14:61836545-61836567 TGGAGTAGAAAGGAAAATGAGGG - Intergenic
1119272584 14:73322045-73322067 CTGATTACTAAGCAAATTGAGGG + Intronic
1119534342 14:75390529-75390551 TGAACAATTAAGTAAATTGATGG + Intergenic
1119961572 14:78863728-78863750 TGGATTATTAAATGAATTAAAGG - Intronic
1120067032 14:80054623-80054645 GAGATTATTAAGGAAATTGGAGG - Intergenic
1121159559 14:91725027-91725049 TGGATTTTAAAGGAACGTGAAGG + Intronic
1121593228 14:95136919-95136941 TGGATAGTTAAGGAATTTGTTGG - Intronic
1121619364 14:95335597-95335619 AGCATTATTAAGCAAAATGAGGG - Intergenic
1122471780 14:101972862-101972884 TGGAAAATTCAGAAAATTGAGGG + Intronic
1202895861 14_GL000194v1_random:9679-9701 TGGAGTTTTAAGACAATTGATGG - Intergenic
1125130859 15:36282324-36282346 TTGATTATTTAGGAAAATAAAGG + Intergenic
1125361316 15:38867434-38867456 TGGATTCTGAAGGAAATAGCTGG + Intergenic
1126624222 15:50670640-50670662 TGGATTATTAATGAATTTTCTGG - Intronic
1128164063 15:65445961-65445983 TAGAATTTTAAGGAGATTGAAGG - Exonic
1128952830 15:71905172-71905194 TGGATAATTAAGGATAAAGATGG + Intronic
1129375560 15:75128370-75128392 TGTTTTGTTAAGGAAATTGGGGG - Intergenic
1131782901 15:95879198-95879220 TGAATTATTAAGAGAATTGTGGG + Intergenic
1134492692 16:14707520-14707542 TTGCATATTTAGGAAATTGAGGG + Intergenic
1134498073 16:14746642-14746664 TTGCATATTTAGGAAATTGAGGG + Intronic
1134582501 16:15382451-15382473 TTGCATATTTAGGAAATTGAGGG - Intergenic
1134812963 16:17182838-17182860 AGGATTACAAAGGAATTTGAAGG + Intronic
1135313818 16:21426502-21426524 TTGCATATTTAGGAAATTGAGGG - Intronic
1135366742 16:21858782-21858804 TTGCATATTTAGGAAATTGAGGG - Intronic
1135445073 16:22512376-22512398 TTGCATATTTAGGAAATTGAGGG + Intronic
1136193794 16:28636915-28636937 TTGCATATTTAGGAAATTGAGGG + Intergenic
1136310482 16:29405205-29405227 TTGCATATTTAGGAAATTGAGGG - Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1138138829 16:54548770-54548792 TGGGTTATTTAATAAATTGAGGG - Intergenic
1138270133 16:55690157-55690179 TGGATTGTTAGGTAAATGGATGG - Intronic
1139255833 16:65541576-65541598 TGAATAATTAAGTAAATAGATGG - Intergenic
1139858167 16:69997591-69997613 TTGCATATTTAGGAAATTGAGGG - Intergenic
1142852794 17:2712196-2712218 TGGATTATTGAGGGAGTGGAGGG + Intronic
1143451750 17:7040871-7040893 TGGCTTAGAAAAGAAATTGAGGG + Intergenic
1144301432 17:13925489-13925511 TGGGTAATTCTGGAAATTGAAGG + Intergenic
1146253050 17:31367062-31367084 TGTAATATTTAGGAAATTAATGG + Intronic
1146987391 17:37233186-37233208 TGGACTCTGAAGAAAATTGAAGG + Intronic
1147746398 17:42697420-42697442 TGGATCCTCAAGGAAAGTGAAGG + Intronic
1148535548 17:48435569-48435591 TGGGGGATTAAGGAGATTGAAGG + Intergenic
1148708749 17:49660656-49660678 TAAATTATTAAGGAAAATAATGG - Intronic
1149155992 17:53630551-53630573 TGGGTGATTATGGAAATTAAAGG + Intergenic
1151082583 17:71345649-71345671 TGGAGTATTAAGGAAAATTCTGG + Intergenic
1154119611 18:11640863-11640885 TTGCATATTTAGGAAATTGAGGG - Intergenic
1155362829 18:25018922-25018944 TGGAGTATGAAGGAAAAAGAGGG - Intergenic
1155539248 18:26850002-26850024 TGGATAATTTAGGAAATTTTTGG - Intergenic
1156159060 18:34337509-34337531 TGCATTAATAAGGAAATATATGG - Intergenic
1156292457 18:35760286-35760308 CAGTGTATTAAGGAAATTGAAGG + Intergenic
1157004553 18:43566437-43566459 GGGATTATTAAGTAAAATAAGGG - Intergenic
1157926489 18:51772458-51772480 TGGATTAATGATGAAAGTGAGGG + Intergenic
1158125737 18:54098087-54098109 CTGATTATTAAGGAACTTGCTGG - Intergenic
1158610694 18:58937663-58937685 TGGGTAATTAATGAAACTGAAGG - Intronic
1159273309 18:66182069-66182091 TGAATAATTAAGGAAATGAATGG + Intergenic
1159353479 18:67304995-67305017 CTTATTATTAAGGAAATTCATGG - Intergenic
1162321274 19:9972143-9972165 TGGATGAATAAGTAAATTAATGG - Intronic
1164397599 19:27879599-27879621 TGGGTAATTCTGGAAATTGAAGG + Intergenic
1165663443 19:37603374-37603396 AGGATAATTATGGAAATTGGAGG + Intronic
1165971001 19:39629780-39629802 TGGATAATTCTGGAAATTAAGGG - Intergenic
1168182770 19:54673589-54673611 TGGATAATTCTGGAAATTAAAGG + Intronic
1168439118 19:56348173-56348195 TGGATGATTCTGGAAATTAAAGG + Intronic
925334964 2:3089963-3089985 ATGATCAATAAGGAAATTGAGGG + Intergenic
925583766 2:5442001-5442023 GGGTTTATTAAGGAAAATGGTGG - Intergenic
926421049 2:12699755-12699777 TGGATGAATAAGTAAATGGATGG + Intergenic
926448695 2:12975602-12975624 TGAATAATTAAGTAAATGGATGG + Intergenic
926463104 2:13158119-13158141 TGGCTTGTTTAGGAAATTTAGGG - Intergenic
927166440 2:20327765-20327787 TGGATTCTTAAAGGAATTTAAGG - Intronic
927225705 2:20764432-20764454 AGGACTATGAAGGAAATTGGAGG - Intronic
927265571 2:21145439-21145461 TGGGTTCTTAAAGAATTTGATGG - Intergenic
928148186 2:28801807-28801829 TGGATTATAAAGCAAAGTTATGG + Exonic
929898268 2:45980092-45980114 TGGAGCATTTAGGAAACTGATGG + Intronic
931327200 2:61238825-61238847 TGTATTTTTAAACAAATTGAAGG + Intronic
933219740 2:79675138-79675160 TGGATAATTAATGACATTTATGG - Intronic
934193176 2:89818244-89818266 TGGATTACAATGGAAATTAATGG - Intergenic
935319940 2:101876729-101876751 TGGATTATTAAGGAAATTGATGG + Intronic
935809099 2:106779064-106779086 TAGATTATTAAGAGAATTGATGG - Intergenic
935985729 2:108671341-108671363 TTGATTTTTAAGGACATTTAAGG + Intronic
936138158 2:109914971-109914993 TTGATTTTTAAGGACATTTAAGG + Intergenic
936206538 2:110456514-110456536 TTGATTTTTAAGGACATTTAAGG - Intronic
937723652 2:125133248-125133270 AGGAATAACAAGGAAATTGAAGG + Intergenic
937918163 2:127109866-127109888 TAGAATATTAAGGAAATTAAGGG - Intergenic
940613882 2:156026338-156026360 TTGATTTTTAAGAAAATAGAGGG + Intergenic
940989855 2:160086133-160086155 TGGGTAATTCTGGAAATTGAAGG - Intergenic
941621571 2:167784881-167784903 TGAATTTTTAAGGTAATTTAAGG + Intergenic
942546599 2:177071170-177071192 AGGATTACTAAGGAAAATCAGGG + Intergenic
943079072 2:183235411-183235433 AGTATTATTAATGCAATTGAGGG - Intergenic
943595967 2:189856906-189856928 TGGAATATTCCGGTAATTGATGG - Intronic
943695124 2:190919111-190919133 TGCATTTTTTAAGAAATTGAAGG - Intronic
943786653 2:191884958-191884980 AGGATAATTAAGAAAAATGATGG - Intergenic
944313964 2:198265683-198265705 TGGCCTATGAAGGAAATAGATGG - Intronic
946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG + Intergenic
946576318 2:221079813-221079835 ATAATTATTAAGGAAATGGAAGG + Intergenic
947268298 2:228305985-228306007 TGGACGATTCCGGAAATTGAAGG - Intergenic
1171423464 20:25034375-25034397 AGGAGTATTCAGGAATTTGAAGG - Intronic
1172262193 20:33577246-33577268 TGGATTTTTAAAAATATTGATGG + Intronic
1172907545 20:38380077-38380099 GGGATTATTTTGGAAATTGATGG + Intergenic
1176615548 21:9025739-9025761 TGGAGTTTTAAGACAATTGATGG - Intergenic
1177108918 21:16999604-16999626 GACATTATTAAGGAAATGGAAGG + Intergenic
1178020088 21:28397746-28397768 GGGAGTATGAAGGAAATTCAAGG + Intergenic
1179120566 21:38541312-38541334 TGGATTACCAAGATAATTGAGGG - Intronic
1179303315 21:40132476-40132498 TGGATTATTTAGGGAATCTAAGG - Intronic
1180639227 22:17284796-17284818 TGGATTATTAATGAAATTTATGG - Intergenic
1181376584 22:22463603-22463625 TGGGTGATTCTGGAAATTGAAGG - Intergenic
1181899851 22:26144656-26144678 TGGAATATTAAGTAAATTAATGG + Intergenic
1182348875 22:29687189-29687211 AGGATTTCCAAGGAAATTGACGG + Intronic
1182743362 22:32585194-32585216 TGGATGAATAAGGAAAGAGAAGG - Intronic
949418835 3:3843129-3843151 AGGATTATTGAGAAAATTAAGGG - Intronic
949565061 3:5236984-5237006 TGGAATATTTAGGAGATTCAGGG - Intergenic
949623385 3:5841699-5841721 TGGGTAATTCAGGAAAGTGAGGG + Intergenic
950133865 3:10566829-10566851 TAGACAATCAAGGAAATTGATGG - Intronic
952112814 3:30144116-30144138 TGGATTATTAAAAAATTAGAAGG - Intergenic
952248051 3:31618779-31618801 TGGATCACTAACGAATTTGAAGG + Intronic
954530449 3:51314280-51314302 TGCTTCATTAAGGAAGTTGAGGG + Intronic
954822290 3:53340744-53340766 TGTATTAGTATGGATATTGAAGG - Intronic
955655787 3:61243423-61243445 TGGATTATCAAGAAAATTAAAGG + Intronic
956480088 3:69664680-69664702 TGGAATGTTAAGGAAATCCAAGG + Intergenic
957271928 3:78041468-78041490 TGGATCATAAAGGAAATAAATGG - Intergenic
957471023 3:80657434-80657456 TGGAATACAAAGGAAAATGAAGG - Intergenic
958145470 3:89618097-89618119 TTGATTATTAAGGTAATCTATGG - Intergenic
958605038 3:96346647-96346669 TGAATTATTAAGTAAATGTAAGG + Intergenic
960536228 3:118817330-118817352 TGGACTATTATGAAAATTAAGGG - Intergenic
961059321 3:123815092-123815114 AGGATTATTATGGAAATAAAGGG - Intronic
963151209 3:142047335-142047357 TGGATTATTAAGCTAATTTATGG - Intronic
963550752 3:146719398-146719420 TGGTTTCTTAAGGAAAAAGATGG + Intergenic
964900729 3:161655777-161655799 TGGATAAATAATGAAATTAAAGG - Intergenic
966120204 3:176512124-176512146 TGGCTGATTCTGGAAATTGAAGG - Intergenic
966688684 3:182722876-182722898 TGGGTGATTCTGGAAATTGAAGG - Intergenic
968162088 3:196434925-196434947 TGGATTATTAAAGAATATGAAGG + Intergenic
969484516 4:7464737-7464759 TGGACTATGGAGGAAATTCAAGG - Intronic
971603685 4:28629837-28629859 TGGATTTTGGAGGACATTGAAGG - Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
973107425 4:46357519-46357541 TAGATGATTGAGGAAACTGAGGG - Intronic
974268858 4:59623569-59623591 AGGATTATGAAGAAAAGTGAGGG + Intergenic
974273397 4:59682228-59682250 ATTATTATTAAGGAAATTTATGG - Intergenic
974727866 4:65819096-65819118 TGAATTATTAAAGTAATAGAAGG + Intergenic
974804733 4:66863398-66863420 TGGGTTAATAAAAAAATTGATGG + Intergenic
975571252 4:75820485-75820507 TGGATTAAAAAGGAAATTGATGG + Intergenic
977020684 4:91755493-91755515 TGTCTTATTAAGGAAATTGAAGG + Intergenic
977262225 4:94811579-94811601 ATGATTATTAAGAGAATTGATGG + Intronic
977337741 4:95719608-95719630 TGGCTTATGAAGCAAATTGCTGG - Intergenic
978310674 4:107382118-107382140 TGGATTCTTAAATAGATTGAGGG + Intergenic
978999964 4:115204989-115205011 TTGATTATTAATTAAACTGAAGG + Intergenic
979156979 4:117406777-117406799 TGCAGTATTAAGGAGAGTGATGG - Intergenic
979479376 4:121198654-121198676 ATGTTTATTAAGGAACTTGAGGG - Intronic
980191635 4:129532308-129532330 TGGCTTGTTAAGGGAATAGAAGG - Intergenic
980328635 4:131381327-131381349 TGGATTAATAAATAAATAGATGG + Intergenic
980458209 4:133072651-133072673 TGTATTAGCAAAGAAATTGAAGG + Intergenic
981003885 4:139854952-139854974 TGGCTGATTTAGGAAATAGAAGG - Intronic
981596928 4:146434978-146435000 AGGAATTTTAAGCAAATTGAGGG + Intronic
981672514 4:147303083-147303105 TTGATTATTAAGGAAAAACAAGG + Intergenic
981681949 4:147409465-147409487 TGGATTATTCTGGAAATAGCTGG - Intergenic
983062451 4:163174807-163174829 TGGGTGATTCTGGAAATTGAAGG + Intergenic
983398426 4:167233559-167233581 TGGTCCATTAAGGAATTTGAGGG - Intronic
984576757 4:181458640-181458662 TGGATTAATAAGGAGTTTCAAGG - Intergenic
984714094 4:182910691-182910713 TGGATTTTTCAGGAAAAGGATGG + Intronic
984719393 4:182955824-182955846 TGGTTTGTTAAGGACATGGAAGG + Intergenic
986847063 5:11768012-11768034 TGGATTATTAGTGGAAATGAAGG - Intronic
987500274 5:18699989-18700011 TGGGTTATTAAGGAAAAAGGAGG + Intergenic
988113982 5:26859268-26859290 TGGATAATTTAAGAAATTAAAGG - Intergenic
989159967 5:38381130-38381152 TGGATAATTAAGTAAATAAAAGG - Intronic
989237829 5:39169935-39169957 TGAACTATTAAGGAAATTAAAGG + Intronic
990044494 5:51412439-51412461 TGAATTATTAAGAAAATTAGAGG - Intergenic
992030613 5:72717698-72717720 AGGATTAGTAAGGAAATGGAAGG + Intergenic
992253111 5:74895346-74895368 TGGATGATTTAGGAAATGTATGG - Intergenic
993179109 5:84526119-84526141 TGTATTATTAATTGAATTGAAGG - Intergenic
993255464 5:85585474-85585496 TGGATAAATAATGAAATTAAGGG - Intergenic
993360003 5:86963422-86963444 GGGATTATAAAAGAAATTGAGGG - Intergenic
993748169 5:91628476-91628498 TGGATAATTAAGGTAATTGCAGG + Intergenic
994687257 5:102970745-102970767 TGACTTATTAAGAAAATAGAGGG + Intronic
994815508 5:104581774-104581796 TGCATAATTAAGTAAATAGATGG - Intergenic
995320830 5:110831895-110831917 TGGATTAATAAGGAATTGTAGGG - Intergenic
995417262 5:111925139-111925161 TGGGTGATTCTGGAAATTGAAGG - Intronic
995417867 5:111930137-111930159 TGCATAATTCAGGCAATTGAGGG - Intronic
995449638 5:112286430-112286452 AGAATTATTAAGGAGAATGACGG - Intronic
1000201013 5:159011189-159011211 TGTTTTCTTAAGGAAGTTGAAGG + Intronic
1000313288 5:160065028-160065050 TGGATTTTGAACGAAATTGATGG - Exonic
1000903063 5:166932034-166932056 TGGAACGTTAAGTAAATTGATGG + Intergenic
1001162883 5:169337122-169337144 TGGGATATAAAGGAAATTTAAGG + Intergenic
1001974546 5:175986570-175986592 TGGATAATTAAGAAAGTTCAGGG + Intronic
1002242888 5:177857209-177857231 TGGATAATTAAGAAAGTTCAGGG - Intergenic
1004137816 6:12985213-12985235 TGGATTATTGAGATAATTTATGG - Intronic
1005890506 6:30134027-30134049 TGGTTTATTGAGCAACTTGAAGG - Intergenic
1006925343 6:37650942-37650964 TGGGATACTAAGGAAAATGAGGG + Intronic
1007649032 6:43405887-43405909 TGGAGTATTGAGGAAAGAGAGGG + Intergenic
1008279208 6:49575876-49575898 TGGTTTATTAAGTCATTTGAAGG - Intergenic
1011673303 6:89705240-89705262 TGTATTTTTAAGCAAATTTATGG + Intronic
1013232635 6:108170896-108170918 TGGATTATTAATGATAATAAGGG - Intronic
1013253830 6:108362639-108362661 TGCATTGATGAGGAAATTGAGGG + Intronic
1013866752 6:114707709-114707731 TGGAAAATTAAGGAAATTTGAGG + Intergenic
1015693151 6:135949095-135949117 TTTATAAATAAGGAAATTGAGGG + Intronic
1016057468 6:139593485-139593507 TGAATTAATAAAGAAATTAATGG + Intergenic
1018161366 6:161046604-161046626 TGGATCATAAAGTAAATTTAAGG + Intronic
1018448807 6:163885810-163885832 TGTATTTTTAATGAATTTGAGGG + Intergenic
1018690677 6:166342133-166342155 TGGATTATTTGGGAAAGCGAGGG + Intronic
1020712702 7:11628903-11628925 AGGATTATTAACAAAATTGTAGG + Intronic
1020735756 7:11947443-11947465 TGGATGAATAATGAAATTAAGGG - Intergenic
1021417683 7:20407043-20407065 TGGATTATGAAGGAAAATTATGG + Intronic
1021758133 7:23875739-23875761 TGGTTGAGTAAGGAAGTTGAGGG + Intergenic
1024175335 7:46834641-46834663 TGAATGATTAAGGGAATGGATGG + Intergenic
1024440629 7:49413317-49413339 TGAATAATTAAGTAAATGGAAGG + Intergenic
1028420699 7:90629517-90629539 TGGAGTGTTTTGGAAATTGATGG + Intronic
1028814079 7:95124025-95124047 TCTATTAATAAGAAAATTGAGGG + Intronic
1031167837 7:118251717-118251739 TGAACAATTAAGGCAATTGAAGG + Intergenic
1032340469 7:131067612-131067634 TGGATTCTTAAGCAAAGTGGAGG + Intergenic
1033032294 7:137838838-137838860 TGGATTATTTCAGAAATGGAAGG - Intronic
1037564070 8:20102420-20102442 TGGATTATTCAGTAAATGGTTGG - Intergenic
1037680618 8:21094374-21094396 TGGATTATTCTGTAAAATGAAGG + Intergenic
1038164802 8:25075122-25075144 TGGATTAGGAGGGAAAATGATGG - Intergenic
1038230900 8:25698694-25698716 TGGCTTATTCAGGATTTTGACGG - Intergenic
1038467258 8:27775294-27775316 TGGACTATTAGGGAAATACAGGG + Intronic
1039247083 8:35620810-35620832 TGGATTCCTAAGGCAATTAAGGG + Intronic
1040366876 8:46726874-46726896 GGGCTTATTGAGGAAATTAAAGG - Intergenic
1040577024 8:48661585-48661607 TGGACAATTAAGTAAATGGATGG - Intergenic
1041307768 8:56480830-56480852 TGGGTTAATGAGGAAATGGAAGG - Intergenic
1041565484 8:59272978-59273000 TGAATAATTAAGTAAATGGATGG - Intergenic
1043176934 8:77033414-77033436 TACATTATTTAGGAAACTGAGGG - Intergenic
1045351111 8:101340523-101340545 TAGATTATTCAAGAAATTGTGGG - Intergenic
1045796015 8:106045259-106045281 TTGATTTTTAAGGGAATTAAAGG - Intergenic
1047376634 8:124304222-124304244 TGCTTTATTAAGGACATTGAAGG - Intergenic
1048458316 8:134598450-134598472 TGGTTTATTAAGAAGAATGAAGG + Intronic
1048961369 8:139582174-139582196 AGGATTAACAAGGAAATTGGAGG - Intergenic
1050347060 9:4700818-4700840 TGTATTATTAAGTAATTTGTGGG - Intronic
1051151187 9:14080920-14080942 TGGAGTCGTATGGAAATTGATGG - Intergenic
1051364012 9:16307969-16307991 TGACTTATTTATGAAATTGATGG - Intergenic
1052090197 9:24318236-24318258 TGGAGTATAAAGGAAAAAGAGGG + Intergenic
1053366214 9:37524263-37524285 TGGATAATTAAGGCAAAAGAGGG - Intronic
1055391983 9:75832887-75832909 TGGAGGATTAAAGAAATTTATGG + Intergenic
1055400230 9:75915644-75915666 TGGAATATTAAAGTAATTCATGG + Intronic
1055605851 9:77969708-77969730 TGGATTTTCCAGGAAATTGGGGG + Intronic
1055803358 9:80065708-80065730 TGGATTATTAGGGAAACTTCAGG + Intergenic
1056289033 9:85123206-85123228 TGGAATATTAAATAAATTGTCGG - Intergenic
1056375580 9:86006867-86006889 TGGATTGTTAAGGAAAGGAAAGG + Intronic
1056467762 9:86875288-86875310 TAAAATATTAAGGAAATAGATGG - Intergenic
1057097175 9:92322298-92322320 GGTATTATTAAGGAAGCTGACGG - Intronic
1057243805 9:93437027-93437049 AGGATTCTTCAGGAAATGGAGGG + Intergenic
1057430204 9:94987162-94987184 TGAATTATTAAGCATCTTGAAGG - Intronic
1058081011 9:100701054-100701076 TGTATTAATAAGGAAACTGAAGG - Intergenic
1058604645 9:106707464-106707486 TGCATTACTAAGGGAGTTGATGG - Intergenic
1058832539 9:108832087-108832109 TGGATTATTAAGAAAGTTCAGGG - Intergenic
1059164238 9:112063574-112063596 GTGATTATAAAGGATATTGAAGG - Intronic
1059774149 9:117458226-117458248 TGAATAATTAAGTAAATGGATGG + Intergenic
1060775501 9:126370891-126370913 AGAATTATTAAAGAAATAGATGG - Intronic
1061010144 9:127949909-127949931 TGGATTATCAGTGAAAATGATGG - Intronic
1186847854 X:13548982-13549004 TGGGGCATTAAGGAAATTAAGGG - Intergenic
1187094057 X:16128024-16128046 TAGATTATTAAGAATGTTGAAGG + Intronic
1187804811 X:23107796-23107818 TGAATTATTAAGTAAATGAATGG - Intergenic
1188186230 X:27118000-27118022 TGGTTTAGTAAGTGAATTGAAGG - Intergenic
1189367643 X:40401394-40401416 TGGAAGATCAAGGAAATAGAAGG - Intergenic
1191948026 X:66556772-66556794 TGGATAAATAATGAAATTAAGGG + Intergenic
1193521276 X:82532251-82532273 TGGAGTAGTACAGAAATTGATGG - Intergenic
1194080159 X:89452691-89452713 TGGATAAATAATGAAATTAAAGG + Intergenic
1194317682 X:92400879-92400901 TAGATGCTTAAGGAAATTGTAGG + Intronic
1194339986 X:92695479-92695501 TTGATTTTTAAGGAAAGTTAAGG - Intergenic
1194698078 X:97080327-97080349 GGTATTATTAAGGAAAATTAAGG - Intronic
1194716731 X:97295141-97295163 TGTATAACTAAGGAAAGTGATGG - Intronic
1194980214 X:100432856-100432878 AGGATTATAAAGAAAGTTGAGGG - Intergenic
1195092668 X:101476813-101476835 TTGAATCTTAAGGAAATAGAAGG + Intronic
1195493109 X:105496464-105496486 AAGATAATTAAGGAAAGTGAAGG + Intronic
1196416303 X:115475412-115475434 TGGATGATGCAGGAGATTGAGGG - Intergenic
1198010206 X:132544823-132544845 TGGATTTATAATAAAATTGAAGG + Intergenic
1200432837 Y:3108751-3108773 TGGATAAATAATGAAATTAAAGG + Intergenic
1200625859 Y:5514161-5514183 TAGATGCTTAAGGAAATTGTAGG + Intronic
1200648365 Y:5812235-5812257 TTGATTTTTAAGGAAAGTTAAGG - Intergenic
1201148936 Y:11084391-11084413 TGGAGTTTTAAGACAATTGATGG - Intergenic
1201589801 Y:15602757-15602779 TGGATTATCACGGAAAGTTATGG - Intergenic
1202021136 Y:20466296-20466318 TGGGTGATAATGGAAATTGAAGG - Intergenic