ID: 935322565

View in Genome Browser
Species Human (GRCh38)
Location 2:101903064-101903086
Sequence TTGTTTCAAACTAAGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935322565_935322568 15 Left 935322565 2:101903064-101903086 CCTCATGGCTTAGTTTGAAACAA No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935322565 Original CRISPR TTGTTTCAAACTAAGCCATG AGG (reversed) Intergenic
No off target data available for this crispr