ID: 935322568

View in Genome Browser
Species Human (GRCh38)
Location 2:101903102-101903124
Sequence GCATTTATCTGTAAACGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935322564_935322568 22 Left 935322564 2:101903057-101903079 CCACTATCCTCATGGCTTAGTTT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322563_935322568 23 Left 935322563 2:101903056-101903078 CCCACTATCCTCATGGCTTAGTT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322562_935322568 24 Left 935322562 2:101903055-101903077 CCCCACTATCCTCATGGCTTAGT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322560_935322568 28 Left 935322560 2:101903051-101903073 CCCACCCCACTATCCTCATGGCT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322561_935322568 27 Left 935322561 2:101903052-101903074 CCACCCCACTATCCTCATGGCTT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322566_935322568 -10 Left 935322566 2:101903089-101903111 CCCAGACGTTATAGCATTTATCT No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data
935322565_935322568 15 Left 935322565 2:101903064-101903086 CCTCATGGCTTAGTTTGAAACAA No data
Right 935322568 2:101903102-101903124 GCATTTATCTGTAAACGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935322568 Original CRISPR GCATTTATCTGTAAACGTTT CGG Intergenic
No off target data available for this crispr