ID: 935325757

View in Genome Browser
Species Human (GRCh38)
Location 2:101935544-101935566
Sequence CCCCTTGCACTTCCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7908
Summary {0: 334, 1: 1454, 2: 2136, 3: 2167, 4: 1817}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935325757_935325764 8 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325764 2:101935575-101935597 CTCCCTCCCCTAGCCAAGGGAGG 0: 9
1: 11
2: 58
3: 149
4: 379
935325757_935325772 17 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325772 2:101935584-101935606 CTAGCCAAGGGAGGGTGTGAGGG No data
935325757_935325763 5 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325763 2:101935572-101935594 GAACTCCCTCCCCTAGCCAAGGG 0: 352
1: 481
2: 420
3: 867
4: 1458
935325757_935325771 16 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG No data
935325757_935325762 4 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325762 2:101935571-101935593 GGAACTCCCTCCCCTAGCCAAGG 0: 325
1: 462
2: 437
3: 988
4: 1573
935325757_935325765 9 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325765 2:101935576-101935598 TCCCTCCCCTAGCCAAGGGAGGG 0: 7
1: 7
2: 76
3: 210
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935325757 Original CRISPR CCCCTTGCACTTCCCAGGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr