ID: 935325759

View in Genome Browser
Species Human (GRCh38)
Location 2:101935549-101935571
Sequence CCTGACCCCTTGCACTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5511
Summary {0: 443, 1: 1439, 2: 1310, 3: 1167, 4: 1152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935325759_935325771 11 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG No data
935325759_935325764 3 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325764 2:101935575-101935597 CTCCCTCCCCTAGCCAAGGGAGG 0: 9
1: 11
2: 58
3: 149
4: 379
935325759_935325762 -1 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325762 2:101935571-101935593 GGAACTCCCTCCCCTAGCCAAGG 0: 325
1: 462
2: 437
3: 988
4: 1573
935325759_935325763 0 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325763 2:101935572-101935594 GAACTCCCTCCCCTAGCCAAGGG 0: 352
1: 481
2: 420
3: 867
4: 1458
935325759_935325772 12 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325772 2:101935584-101935606 CTAGCCAAGGGAGGGTGTGAGGG No data
935325759_935325774 26 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325774 2:101935598-101935620 GTGTGAGGGACTGTGCTGTGAGG No data
935325759_935325765 4 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325765 2:101935576-101935598 TCCCTCCCCTAGCCAAGGGAGGG 0: 7
1: 7
2: 76
3: 210
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935325759 Original CRISPR CCTGACCCCTTGCACTTCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr