ID: 935325771

View in Genome Browser
Species Human (GRCh38)
Location 2:101935583-101935605
Sequence CCTAGCCAAGGGAGGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935325759_935325771 11 Left 935325759 2:101935549-101935571 CCTGGGAAGTGCAAGGGGTCAGG 0: 443
1: 1439
2: 1310
3: 1167
4: 1152
Right 935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG No data
935325757_935325771 16 Left 935325757 2:101935544-101935566 CCTCACCTGGGAAGTGCAAGGGG 0: 334
1: 1454
2: 2136
3: 2167
4: 1817
Right 935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935325771 Original CRISPR CCTAGCCAAGGGAGGGTGTG AGG Intergenic
No off target data available for this crispr