ID: 935326573

View in Genome Browser
Species Human (GRCh38)
Location 2:101943049-101943071
Sequence CTGGAAGGTCGAAAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935326566_935326573 -3 Left 935326566 2:101943029-101943051 CCAGGGAATGCAGGCAGCCTCTG No data
Right 935326573 2:101943049-101943071 CTGGAAGGTCGAAAAGGGCAGGG No data
935326564_935326573 4 Left 935326564 2:101943022-101943044 CCCAGAGCCAGGGAATGCAGGCA No data
Right 935326573 2:101943049-101943071 CTGGAAGGTCGAAAAGGGCAGGG No data
935326565_935326573 3 Left 935326565 2:101943023-101943045 CCAGAGCCAGGGAATGCAGGCAG No data
Right 935326573 2:101943049-101943071 CTGGAAGGTCGAAAAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935326573 Original CRISPR CTGGAAGGTCGAAAAGGGCA GGG Intergenic
No off target data available for this crispr