ID: 935328724

View in Genome Browser
Species Human (GRCh38)
Location 2:101961058-101961080
Sequence CTGGCTGTGCTGCGGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935328719_935328724 4 Left 935328719 2:101961031-101961053 CCTTCATATCTGGGAGGGCAGGA No data
Right 935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG No data
935328715_935328724 11 Left 935328715 2:101961024-101961046 CCTGGCACCTTCATATCTGGGAG No data
Right 935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG No data
935328711_935328724 20 Left 935328711 2:101961015-101961037 CCCAAGGGTCCTGGCACCTTCAT No data
Right 935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG No data
935328709_935328724 30 Left 935328709 2:101961005-101961027 CCTGGGTGCTCCCAAGGGTCCTG No data
Right 935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG No data
935328712_935328724 19 Left 935328712 2:101961016-101961038 CCAAGGGTCCTGGCACCTTCATA No data
Right 935328724 2:101961058-101961080 CTGGCTGTGCTGCGGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935328724 Original CRISPR CTGGCTGTGCTGCGGTAGGT GGG Intergenic
No off target data available for this crispr