ID: 935330148

View in Genome Browser
Species Human (GRCh38)
Location 2:101971219-101971241
Sequence GTGGATATACAAAAAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935330148_935330151 3 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330151 2:101971245-101971267 CTCACTCCATTTTTCCTCCAGGG No data
935330148_935330157 22 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330157 2:101971264-101971286 AGGGAGTCTGGGCTCATTGTAGG No data
935330148_935330150 2 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330150 2:101971244-101971266 TCTCACTCCATTTTTCCTCCAGG No data
935330148_935330158 23 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330158 2:101971265-101971287 GGGAGTCTGGGCTCATTGTAGGG No data
935330148_935330153 10 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330153 2:101971252-101971274 CATTTTTCCTCCAGGGAGTCTGG No data
935330148_935330159 24 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330159 2:101971266-101971288 GGAGTCTGGGCTCATTGTAGGGG No data
935330148_935330154 11 Left 935330148 2:101971219-101971241 CCATTGTCTTTTTGTATATCCAC No data
Right 935330154 2:101971253-101971275 ATTTTTCCTCCAGGGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935330148 Original CRISPR GTGGATATACAAAAAGACAA TGG (reversed) Intergenic
No off target data available for this crispr