ID: 935331532

View in Genome Browser
Species Human (GRCh38)
Location 2:101981006-101981028
Sequence CAAACTGCACGAAGTGATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935331532_935331533 -3 Left 935331532 2:101981006-101981028 CCGATATCACTTCGTGCAGTTTG No data
Right 935331533 2:101981026-101981048 TTGTTCCCACTCTTGCTCACTGG No data
935331532_935331538 13 Left 935331532 2:101981006-101981028 CCGATATCACTTCGTGCAGTTTG No data
Right 935331538 2:101981042-101981064 TCACTGGGGCCCCTATTTTTAGG No data
935331532_935331535 -1 Left 935331532 2:101981006-101981028 CCGATATCACTTCGTGCAGTTTG No data
Right 935331535 2:101981028-101981050 GTTCCCACTCTTGCTCACTGGGG No data
935331532_935331534 -2 Left 935331532 2:101981006-101981028 CCGATATCACTTCGTGCAGTTTG No data
Right 935331534 2:101981027-101981049 TGTTCCCACTCTTGCTCACTGGG No data
935331532_935331539 14 Left 935331532 2:101981006-101981028 CCGATATCACTTCGTGCAGTTTG No data
Right 935331539 2:101981043-101981065 CACTGGGGCCCCTATTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935331532 Original CRISPR CAAACTGCACGAAGTGATAT CGG (reversed) Intergenic
No off target data available for this crispr