ID: 935332162

View in Genome Browser
Species Human (GRCh38)
Location 2:101985264-101985286
Sequence GGCTAGGAATGCCGCCATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935332149_935332162 20 Left 935332149 2:101985221-101985243 CCCTGGAAGTGACCAGATGTGGT 0: 1
1: 0
2: 2
3: 9
4: 152
Right 935332162 2:101985264-101985286 GGCTAGGAATGCCGCCATCCGGG 0: 1
1: 0
2: 0
3: 6
4: 80
935332150_935332162 19 Left 935332150 2:101985222-101985244 CCTGGAAGTGACCAGATGTGGTC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 935332162 2:101985264-101985286 GGCTAGGAATGCCGCCATCCGGG 0: 1
1: 0
2: 0
3: 6
4: 80
935332151_935332162 8 Left 935332151 2:101985233-101985255 CCAGATGTGGTCTCAAGAGATGG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 935332162 2:101985264-101985286 GGCTAGGAATGCCGCCATCCGGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935332162 Original CRISPR GGCTAGGAATGCCGCCATCC GGG Intergenic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
900537851 1:3187589-3187611 GGCTCTTAATGCCGCCAGCCCGG - Intronic
900602377 1:3508701-3508723 GGCTCTGAATCCCCCCATCCTGG - Intronic
901018046 1:6242756-6242778 GCCTGGGAACGCCGCTATCCTGG + Intergenic
901733087 1:11294629-11294651 TGGTAGGAATGCCACCAGCCAGG - Intronic
906237693 1:44221774-44221796 AGCTAGGAATGCTGCCACCAGGG - Intronic
916233201 1:162561137-162561159 GGCTCGGAAATCCGCCACCCTGG + Intergenic
916998135 1:170323909-170323931 GCCTAGGAATACAGCCAGCCAGG - Intergenic
918139987 1:181711988-181712010 GACTAGTAGTGCCGCCATCTAGG + Intronic
919012561 1:191983778-191983800 GGCTAAGATTGCAGGCATCCAGG + Intergenic
1063970793 10:11380025-11380047 GGCCAGGAGTGCAGCCAGCCAGG - Intergenic
1070568190 10:77619858-77619880 TGCTGGGAATGCCGCCTTCCTGG - Intronic
1073640283 10:105245619-105245641 TGCTGGGAATGCCCTCATCCAGG + Exonic
1084787615 11:71452754-71452776 TGCTGGGAATCCCGCCACCCTGG - Intronic
1086134820 11:83434994-83435016 GCCAAGGAATGCCCCCAGCCTGG - Intergenic
1090662947 11:128894846-128894868 GGCAAGGGTTCCCGCCATCCTGG - Intronic
1096958476 12:55551663-55551685 TGCTAGGAATCCCCCCAACCAGG - Exonic
1100545786 12:95600758-95600780 GGCTATGAATGAGGCCATCTTGG + Intergenic
1101316196 12:103631406-103631428 GGATAGGAATGCCTACTTCCTGG - Intronic
1104758517 12:131283416-131283438 GGCTGGGAATGCCGGGAGCCAGG + Intergenic
1112434627 13:99383065-99383087 GGCTGAGAATGCTGCCACCCTGG - Intronic
1132813888 16:1816913-1816935 GCCCGGCAATGCCGCCATCCGGG - Exonic
1139943038 16:70619877-70619899 GCCAAGGAATGCCGGCAGCCCGG - Intronic
1139943706 16:70624194-70624216 GCCAAGGAATGCCGGCAGCCCGG - Intronic
1145819507 17:27821278-27821300 GGGTAGGAAAGCCACCATCTGGG - Intronic
1146646807 17:34581537-34581559 GGCGAGGAAAGACGCGATCCCGG - Intronic
1147359447 17:39921879-39921901 GGCCAGGGCTGCTGCCATCCTGG - Intronic
1150131167 17:62670030-62670052 GGCTAGGCATGCCCACACCCGGG - Intronic
1152748711 17:82052681-82052703 GGCTGGAAAAGCCGCCATGCCGG - Intronic
1156762773 18:40613368-40613390 GGCTAGGAATGCTGACTTTCTGG - Intergenic
1157690361 18:49677011-49677033 GGCAAGGGATGCTGACATCCTGG + Intergenic
1160171249 18:76557252-76557274 GGATAGAAATGCCAACATCCAGG - Intergenic
1160810250 19:1010187-1010209 GGGGAGGAAAGCCGCCTTCCGGG + Exonic
1166326391 19:42053658-42053680 GGCCATGAATGCCACCACCCTGG - Exonic
929283791 2:40113283-40113305 GGCTAGGAATGTCTCCAGCCTGG + Intronic
930104229 2:47627639-47627661 GGATAGGATGACCGCCATCCTGG + Intergenic
931867770 2:66431013-66431035 GGCTTGAAATGCCTCCATACAGG + Intergenic
934660987 2:96143657-96143679 CTCTAGGAATGCCGGCATGCTGG - Exonic
935332162 2:101985264-101985286 GGCTAGGAATGCCGCCATCCGGG + Intergenic
938224759 2:129606229-129606251 GGCGAGGAACACAGCCATCCAGG + Intergenic
940923870 2:159342098-159342120 ACCTAGGAATGCAGCCAACCAGG + Intronic
943051167 2:182914970-182914992 AGCTGGGAATGCAGCCATACCGG + Intronic
944265272 2:197717669-197717691 GGCTTGCAATGCCGCCATCTTGG - Intronic
945554699 2:211263769-211263791 GCCAAGGAATGCCTGCATCCCGG + Intergenic
948087388 2:235262942-235262964 GCCTGGGAATGACGCCATCATGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG + Intergenic
954614381 3:51962114-51962136 GGCTGGGAATGTGGCCAGCCTGG - Intronic
956230863 3:67014734-67014756 GGTTAGGAATGACAACATCCAGG + Intergenic
963544964 3:146645206-146645228 GGCTAAGAATGCCAACAACCAGG - Intergenic
966849307 3:184155177-184155199 GTCCGGGAACGCCGCCATCCCGG + Intronic
968844395 4:3031863-3031885 TGCTAGGAATGCCCACACCCAGG - Intronic
969617757 4:8263258-8263280 GGCTAGCGATGCTGCAATCCAGG - Intergenic
971029563 4:22621620-22621642 GGCAAGGAAAAGCGCCATCCCGG - Intergenic
978754457 4:112286951-112286973 GGCGTGCAATGGCGCCATCCCGG - Intronic
985963912 5:3325043-3325065 ACCTTGGACTGCCGCCATCCAGG + Intergenic
987241076 5:16000234-16000256 GGCTTGGACTGCTGCCTTCCAGG - Intergenic
988721742 5:33885910-33885932 GGCTTGGTATTCTGCCATCCAGG + Intronic
994126098 5:96170290-96170312 GCCAAGGAATGCCGGCAGCCCGG - Intergenic
994381972 5:99081879-99081901 ACCTAGGAATGCAGCCAGCCAGG - Intergenic
998292544 5:140928473-140928495 TGGGAGGAATGCCACCATCCCGG - Exonic
1000617748 5:163447895-163447917 TGCTTGGAATGCAGCCATGCTGG + Exonic
1001203165 5:169737751-169737773 GTCCAGGAATGCCACCTTCCAGG - Intronic
1002464739 5:179401524-179401546 GGCTGGGAATGTTGCCCTCCTGG - Intergenic
1015714325 6:136175485-136175507 TGCTAGTAATCCTGCCATCCAGG + Intronic
1018434501 6:163748684-163748706 TCCTAGGAATGCCGCCAGCATGG + Intergenic
1018959162 6:168434432-168434454 GGCTAGTTTTGCCCCCATCCTGG - Intergenic
1022997865 7:35776440-35776462 AGCTAGGAATTCCTCCATCCTGG + Intergenic
1023499504 7:40832575-40832597 GGCTAGGAGTGCTCACATCCGGG - Intronic
1023761324 7:43467686-43467708 GGCAAGGAATGGCTCCATTCAGG + Intronic
1028244298 7:88457879-88457901 AGCTTGGAATGCAGCCCTCCAGG + Intergenic
1028982286 7:96980080-96980102 GGCCAGGAATGTGGCCAGCCAGG + Intergenic
1034162786 7:149005225-149005247 GGATGTCAATGCCGCCATCCTGG - Exonic
1038272757 8:26089243-26089265 GGGTGGGACAGCCGCCATCCTGG - Intergenic
1042769597 8:72365342-72365364 GGCCAGGAATGCCAGCAGCCAGG + Intergenic
1047523630 8:125614822-125614844 GGCTAGGAATGGAGCCAGGCGGG - Intergenic
1050344093 9:4669222-4669244 GGCAAGGAATGCAGCCCTGCAGG - Intergenic
1055782874 9:79838777-79838799 GGCTAGGAATACAGCCAACTAGG - Intergenic
1056323897 9:85460943-85460965 GCCAAGGAATGCCGGCAGCCCGG + Intergenic
1058351054 9:104024591-104024613 AGCTAGCAATGCCACCATGCTGG + Intergenic
1059794576 9:117678589-117678611 GGCTAGGAATGACCCAATCTGGG + Intergenic
1061583077 9:131549383-131549405 GCCGAGGAATGCCCCCAGCCCGG + Intergenic
1188810436 X:34647971-34647993 ATCTAGGAATGCAGCCAACCAGG + Intronic
1192767456 X:74156506-74156528 GGCTAGGAATACAGCTAACCAGG + Intergenic
1194054187 X:89110325-89110347 GGCTTGCCATGCCCCCATCCTGG - Intergenic
1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG + Intergenic
1200359849 X:155592975-155592997 GGCTAGGCCTGCCCCCATCTGGG + Intronic