ID: 935332267

View in Genome Browser
Species Human (GRCh38)
Location 2:101985844-101985866
Sequence TACCCTCATCACCCCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 189}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935332267_935332280 25 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332280 2:101985892-101985914 TAATACCCAGAGCGGTCGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
935332267_935332276 22 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332276 2:101985889-101985911 GCCTAATACCCAGAGCGGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 57
935332267_935332278 23 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332278 2:101985890-101985912 CCTAATACCCAGAGCGGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
935332267_935332284 30 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332284 2:101985897-101985919 CCCAGAGCGGTCGGGGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 170
935332267_935332282 29 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332282 2:101985896-101985918 ACCCAGAGCGGTCGGGGGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 189
935332267_935332275 21 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332275 2:101985888-101985910 AGCCTAATACCCAGAGCGGTCGG 0: 1
1: 0
2: 1
3: 1
4: 60
935332267_935332271 -6 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332271 2:101985861-101985883 AGGGTAGATAGAGGCCCAGAAGG 0: 1
1: 0
2: 3
3: 23
4: 273
935332267_935332281 26 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332281 2:101985893-101985915 AATACCCAGAGCGGTCGGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 63
935332267_935332279 24 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332279 2:101985891-101985913 CTAATACCCAGAGCGGTCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 28
935332267_935332274 17 Left 935332267 2:101985844-101985866 CCTGGCCCGGGGTGATGAGGGTA 0: 1
1: 0
2: 3
3: 23
4: 189
Right 935332274 2:101985884-101985906 TGAGAGCCTAATACCCAGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935332267 Original CRISPR TACCCTCATCACCCCGGGCC AGG (reversed) Intergenic
900090848 1:919816-919838 TCCCCTCCACAACCCGGGCCAGG + Intergenic
900190043 1:1349391-1349413 CACGCTCAGGACCCCGGGCCGGG - Intergenic
900461989 1:2805999-2806021 CACCCTCATCTCCCAGTGCCTGG + Intergenic
900736080 1:4300319-4300341 TGCCCTAGTCACCCCAGGCCAGG - Intergenic
900847392 1:5114874-5114896 TCCCCTCCTCACCCCTGGTCCGG + Intergenic
901216101 1:7556198-7556220 TGCCCTAGTCACCCCAGGCCAGG - Intronic
901876529 1:12169913-12169935 CCTCCTCATCACCCAGGGCCTGG + Intronic
902533086 1:17102938-17102960 TGCCTTCATCACCCAGGGCCTGG - Intronic
902717694 1:18283663-18283685 TTCCCTCAACACCCCTGCCCTGG + Intronic
902860818 1:19244166-19244188 TACCCTCATTACCCCGTGAATGG - Intronic
903951550 1:26998650-26998672 TTCCCCCATCGCCCCTGGCCAGG - Intronic
904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG + Intergenic
905468785 1:38176020-38176042 TGCCCCCATCACCCAGGGCATGG - Intergenic
915111464 1:153566745-153566767 CACCCTCCTCCCCCAGGGCCAGG + Intronic
917120554 1:171641466-171641488 TGACCTAATCACCCAGGGCCTGG - Intronic
921212349 1:212911260-212911282 TCCCCTCATCACACCTGGTCCGG + Intergenic
922533367 1:226361674-226361696 TTGCCTCATCTCCCCGGGGCTGG + Intronic
922803308 1:228373711-228373733 GACCCTCCTGACCCCGTGCCTGG + Intronic
923220843 1:231891619-231891641 TGCCCTAATCACCCCAGACCAGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1067522347 10:47017269-47017291 TGCCCTAATCACCCAGGGCCAGG + Intergenic
1068955814 10:62818050-62818072 TCCCTTTTTCACCCCGGGCCCGG + Intronic
1070175628 10:73967055-73967077 CATCATCATCACCCGGGGCCAGG + Intergenic
1073208556 10:101781183-101781205 TACCCTCATGGCCCTGGGCTAGG - Intergenic
1073709551 10:106021586-106021608 TCCCCTCCTCACACCGGGTCCGG - Intergenic
1074740708 10:116482400-116482422 TCCCCTCCTCACACCGGGTCCGG + Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076920865 10:133454123-133454145 GACCCTCATGCCCCGGGGCCTGG - Intergenic
1077097621 11:805569-805591 TACCCCCGTCACCCCGGCCTGGG - Intronic
1077296818 11:1830244-1830266 CACCCTCATCAGCTGGGGCCCGG - Intronic
1077305804 11:1868248-1868270 CCCCCTCTTCACTCCGGGCCAGG - Intronic
1077318800 11:1931423-1931445 CACCCTCCTCACCCAGGGACAGG + Intronic
1081072237 11:38625813-38625835 TACCCTCATCAGCCTGGGAAAGG - Intergenic
1084320757 11:68372250-68372272 TTTCCTCATCACCACGGTCCCGG - Intronic
1084667536 11:70584513-70584535 TGCCCCCATCACCCCAGGGCTGG + Intronic
1089614798 11:119689222-119689244 TGCGCTCCTCACCCTGGGCCTGG + Intronic
1089760797 11:120721655-120721677 TGCCCTAATCACCCCGGGCCAGG - Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090270089 11:125379977-125379999 TACCCTCATCACCTCTCCCCAGG - Intronic
1095729598 12:45492026-45492048 TACTCTCATCAGCCCGGGAAAGG - Intergenic
1098336694 12:69412080-69412102 GACCCTCATCACCTCGTGTCTGG - Intergenic
1099817512 12:87668265-87668287 TTTCCTCATCACCCCTGTCCAGG - Intergenic
1102026495 12:109716782-109716804 TTCCCTCATCTCCCTGGGCTTGG + Intronic
1102593885 12:113977892-113977914 TACCATCATCAGGCCGGGCGCGG - Intergenic
1102597691 12:114005483-114005505 TGCCTTAATCACCCCGGGGCTGG - Intergenic
1102736340 12:115163924-115163946 TCCGCTAATCTCCCCGGGCCTGG + Intergenic
1103216142 12:119202773-119202795 TGCCCTAATCACCCAGGGCCAGG + Intronic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103537234 12:121641415-121641437 CAGCGGCATCACCCCGGGCCAGG + Exonic
1109352843 13:61206516-61206538 TCCCCTCCTCACACCGGGTCCGG + Intergenic
1111557847 13:89905107-89905129 TATCCTCATCACCCACTGCCAGG + Intergenic
1112033501 13:95477352-95477374 TGCCCTAATCACCCAGGACCAGG - Intronic
1112595643 13:100804704-100804726 TGCCCTCATCACCCAGGGCCAGG + Intergenic
1113600842 13:111567101-111567123 TACCATCATCAACCAGGGGCGGG + Intergenic
1113736089 13:112679974-112679996 TCTCCTCATCACCCTGGGCCAGG + Intronic
1113956031 13:114100209-114100231 CGCCCTCAGCACCGCGGGCCGGG - Intronic
1119716990 14:76866634-76866656 CAGCCTCTTCACCCCCGGCCTGG - Intronic
1121251145 14:92500222-92500244 TACCCTCATCACCCCATCACTGG + Exonic
1122040927 14:98986955-98986977 TACCCTCCTCACACCTGGTCCGG + Intergenic
1122625979 14:103085499-103085521 CACCCTGCACACCCCGGGCCAGG - Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718773 15:23046528-23046550 TACCCCCAGCACCTCTGGCCGGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1124017883 15:25893105-25893127 TATCCTCATCACACTGGGCTGGG - Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1129974646 15:79812105-79812127 TACCGTCATCTGCCCTGGCCAGG + Intergenic
1131882584 15:96875788-96875810 TCCCCTCCTCACACCGGGTCTGG - Intergenic
1132750335 16:1454690-1454712 CACCCTCAGCACCCGGGGCGGGG + Intronic
1133264414 16:4574843-4574865 TACCCTCAGCACCCAGGACCCGG - Intronic
1133271779 16:4614036-4614058 TACACACATCACACCGTGCCGGG + Intronic
1133982324 16:10642344-10642366 TGCTCTAATCACCCCAGGCCAGG + Intronic
1134136765 16:11681670-11681692 CCCCCTCATCACCCTGGCCCAGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135070200 16:19345267-19345289 TGCCCTAATCACCCAGCGCCAGG + Intergenic
1135326307 16:21527937-21527959 AACACACTTCACCCCGGGCCTGG + Intergenic
1138553084 16:57757733-57757755 GACCCTGACCACCCCGGGGCGGG - Intergenic
1139001801 16:62519751-62519773 TGCCCTAGTCACCCAGGGCCAGG - Intergenic
1141673884 16:85507388-85507410 TGCCCTCCCCACCCCGGCCCAGG - Intergenic
1142644826 17:1304912-1304934 TACCCTCAGCACACCAGGCTGGG - Intergenic
1143451034 17:7036763-7036785 TCCAGTCATCACCACGGGCCTGG - Exonic
1145815073 17:27789455-27789477 TCCCCCCAACACCCCGGGTCTGG + Intronic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1149439342 17:56661988-56662010 TCCCCTCACCACCCAGGGCCAGG + Intergenic
1149806233 17:59620180-59620202 AGCCCTCACCAGCCCGGGCCCGG - Intronic
1151718302 17:75842670-75842692 GGCCCTCATCACCCCCGCCCGGG + Intronic
1152242765 17:79168850-79168872 TGCCTTCATGACCCAGGGCCAGG - Intronic
1152805436 17:82353679-82353701 TCCCCCCATCACCCAGGGCCAGG - Intergenic
1155173745 18:23285775-23285797 TCCCCTCCTCACACCGGGTCCGG + Intronic
1155892764 18:31288218-31288240 TCCCCTCCTCACACCTGGCCCGG - Intergenic
1156310783 18:35919689-35919711 AGCCCCCATCACCCCTGGCCTGG - Intergenic
1157710997 18:49849698-49849720 TACCCCCACCATCCCAGGCCGGG - Intronic
1158872546 18:61702306-61702328 TACCTTCCTCACCCCAGACCGGG - Intergenic
1158897127 18:61924756-61924778 TACCCTCCTCACCCAGGGCTGGG - Intergenic
1159629061 18:70728151-70728173 TGCCCTAATCACCCCAGGCCCGG + Intergenic
1160659331 19:291058-291080 GACCCCCATCCCCCTGGGCCTGG + Exonic
1161623136 19:5309803-5309825 CACCCCCATCATCCCTGGCCTGG + Intronic
1162992895 19:14314783-14314805 CACCCTCATCACTCCAGGCTTGG - Intergenic
1163190433 19:15673168-15673190 TCCCCTCTTCATCCCAGGCCAGG - Intronic
1163705100 19:18807907-18807929 TATCCTCACCACCACGGGGCTGG + Intergenic
1165838606 19:38773677-38773699 TCCCCCCATCACCCAGGGCCCGG + Intergenic
1165840956 19:38789020-38789042 TCCCCCCATCACCCAGAGCCCGG - Intergenic
1166257743 19:41618576-41618598 TGCCCTCTTCACCCAGGCCCTGG - Intronic
1166410400 19:42552723-42552745 TGCCCTCTTCACCCAGGCCCTGG - Intronic
1167659759 19:50789802-50789824 TGCCCTGATCACCCGGGGCAGGG - Intergenic
1168051519 19:53833020-53833042 TCCCCTCCTCACACCCGGCCCGG + Intergenic
1168143146 19:54403041-54403063 TGCCTTCATCACCCAGGGCCAGG + Intergenic
927148687 2:20183509-20183531 CACCCTCATCACCACTGTCCTGG - Intergenic
927894975 2:26775774-26775796 TACCCACCTCACCCAGGGCTTGG - Intronic
928778234 2:34791454-34791476 TCCCCTCCTCACACCGGGTCCGG + Intergenic
928857093 2:35814806-35814828 TCCCCTCCTCACACCGGGTCCGG + Intergenic
929240330 2:39647233-39647255 TACCCTAACCACCCAGGGCCAGG - Intergenic
933574801 2:84055186-84055208 GACCCTAGTCACCCCCGGCCTGG + Intergenic
935132892 2:100274650-100274672 CACCCTGATCACCCAGGGCCAGG + Exonic
935146605 2:100399721-100399743 TACACTCATGACCTCTGGCCAGG + Intronic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
937278666 2:120702665-120702687 TACCCACATCACCCCGTTACTGG - Intergenic
938077350 2:128346841-128346863 CCCCCGCCTCACCCCGGGCCGGG + Intergenic
940876963 2:158907481-158907503 TACCCCCACCACCCTGGGACTGG - Intergenic
941935965 2:170981614-170981636 TCCCCTCCTCACACCGGGTCCGG - Intergenic
943460249 2:188164835-188164857 TCCCCTCATCACACCCGGTCTGG - Intergenic
947746987 2:232512965-232512987 CAGCCTCATCACTCAGGGCCAGG - Intergenic
948588983 2:239037567-239037589 TGTCCTAATCAGCCCGGGCCAGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1169509657 20:6249816-6249838 TGCCCTCATCACCCCAGGGCTGG - Intergenic
1170639255 20:18137589-18137611 TACCAACCTCACCCCGGGCGGGG - Intergenic
1170680517 20:18521595-18521617 TCCCCTCCTCACACCCGGCCTGG - Intronic
1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG + Intergenic
1175996512 20:62814468-62814490 TGCCCTTGTCACCCTGGGCCAGG + Intergenic
1176045344 20:63089733-63089755 TGCCCTCAGGACCGCGGGCCAGG + Intergenic
1176254901 20:64146748-64146770 TCCCCTCAAGACCCCAGGCCTGG + Intergenic
1179279833 21:39924964-39924986 TACCCTCATGCCCCTGGGCCAGG - Intronic
1179560734 21:42214583-42214605 TGCCCTCGTCATCCCAGGCCGGG - Intronic
1179975538 21:44863577-44863599 AACCCTCACCACCCTGGGCAGGG - Intronic
1180080341 21:45483734-45483756 TTCCCTCATCACCCCCATCCTGG - Intronic
1180262310 21:46680509-46680531 TTCCCTAATCACCCCAGGGCCGG + Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181541023 22:23573427-23573449 TACCCCCATCACCCAGGGCGTGG - Exonic
1181550927 22:23638785-23638807 TACCCTCATCACCCAGAGCGTGG - Intergenic
1181797357 22:25319903-25319925 TACCCCCATCACCCAGGGCGTGG + Intergenic
1182330735 22:29550015-29550037 TACCCTCTTCCCCCTGAGCCTGG + Intronic
1183338677 22:37266035-37266057 AACCATCAGCACCCCTGGCCTGG + Intergenic
1183366860 22:37411443-37411465 TCCCCTCCTCACCCAGGGCTGGG - Intronic
1183635749 22:39061477-39061499 TCCCCTCCTCACACCGGGTCTGG - Intronic
1185148323 22:49151037-49151059 TGCCCTCATAAACCCGGGTCTGG + Intergenic
1185179376 22:49350299-49350321 AGCCCTCATCGCCCCGGGCCAGG - Intergenic
950465506 3:13150990-13151012 TGCCCTCATCCTCCTGGGCCAGG + Intergenic
950609765 3:14118578-14118600 AACCCTCAGCACACGGGGCCAGG + Intronic
950704756 3:14772908-14772930 AAGCCCCAGCACCCCGGGCCGGG - Exonic
953167415 3:40477473-40477495 TACCCTTGTCACCCGGGGCTGGG + Intronic
954628646 3:52036366-52036388 TGCTCTCATCCCCCAGGGCCTGG + Intergenic
961336019 3:126180251-126180273 TAGCCTGATGACCCCTGGCCAGG + Intronic
961880984 3:130061029-130061051 TCCCCTCCTCACCCCGGGTCCGG + Intergenic
964984941 3:162726501-162726523 TCCCCTCCTCACACCGGGTCTGG - Intergenic
968690349 4:1986896-1986918 TGCCATCAGCACACCGGGCCAGG + Intronic
968714665 4:2147489-2147511 CACCCTCTTCACCCTGGGCATGG - Intronic
968812574 4:2806630-2806652 CACCCTCACCACCCTCGGCCTGG + Intronic
968975944 4:3822134-3822156 AAGCCTCATCCCCCTGGGCCTGG + Intergenic
977010245 4:91625844-91625866 TACCCTCCTCACACCTGGTCTGG + Intergenic
979146545 4:117253843-117253865 TCCCCTCCTCACACCCGGCCCGG + Intergenic
981075530 4:140587532-140587554 TACCACCTTCACCCCAGGCCAGG + Intergenic
981292225 4:143089505-143089527 TACTGTCATCATCCTGGGCCAGG - Intergenic
982497177 4:156107424-156107446 TCCCCTCCTCACACCGGGTCTGG - Intergenic
985896113 5:2750983-2751005 TGCCCTCCCCACCCGGGGCCCGG + Intronic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986997214 5:13620924-13620946 TGGCCTCTTCACCCCAGGCCAGG + Intergenic
988492503 5:31716887-31716909 TGCCCTAATCATCCAGGGCCAGG - Intronic
994189833 5:96857211-96857233 TTCCCTGATCTCCCAGGGCCAGG + Intronic
994774293 5:104024757-104024779 TGCACACATCGCCCCGGGCCAGG + Intergenic
995855873 5:116591595-116591617 TATCCTCATCACCCCTGCACTGG + Intergenic
996450008 5:123610326-123610348 TACACTCATCAACCCAGGTCAGG + Intronic
997980179 5:138464040-138464062 AACACTCCTCACCCCGAGCCTGG - Intergenic
998156226 5:139788547-139788569 AACCCCCATCAACCCAGGCCTGG + Intergenic
1001986343 5:176076670-176076692 TGGCCTCATCACCCCAGGCTAGG + Intronic
1002026901 5:176401889-176401911 TGCCCTCACCGCCCCTGGCCTGG + Intronic
1002230525 5:177761454-177761476 TGGCCTCATCACCCCAGGCTAGG - Intronic
1002264811 5:178022294-178022316 TGGCCTCATCACCCCAGGCTAGG + Intronic
1002701933 5:181130583-181130605 TCCCCTCTTCACCCCGTGTCTGG - Intergenic
1002703863 5:181147563-181147585 TCCCCTCCTCACCCCGTGTCTGG + Intergenic
1002845053 6:938489-938511 TGCCCTAATCCCCCAGGGCCAGG + Intergenic
1007043157 6:38744232-38744254 CACCCTCATCACCCCACTCCTGG - Intronic
1007653222 6:43435932-43435954 TTCCCTCCTCACCCTGTGCCAGG - Intronic
1010761797 6:79732656-79732678 TGCCCTAATCACCCAGGGTCAGG + Intergenic
1012014462 6:93834035-93834057 TCCCCTCCTCACACCTGGCCTGG - Intergenic
1014048809 6:116927293-116927315 TATCCTCATCACACCGAGCATGG + Exonic
1014395941 6:120926593-120926615 TACCCTCCTCACACCCGGTCCGG + Intergenic
1016190212 6:141255644-141255666 TACCCCCATGACCCTGGGCATGG - Intergenic
1021807938 7:24375348-24375370 TGCTCTCATCACCCAGGGTCAGG + Intergenic
1021957400 7:25839722-25839744 TACCTTCACCACCCCAGCCCTGG - Intergenic
1023152541 7:37215563-37215585 TGCCCTAACCACCCAGGGCCAGG + Intronic
1023904471 7:44512664-44512686 TCCCATCTTCACCTCGGGCCTGG - Exonic
1024413175 7:49070884-49070906 CGCCCTGATCACCCAGGGCCAGG + Intergenic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1027045923 7:74991429-74991451 TACCCACCCCACCCCAGGCCAGG + Intronic
1030163689 7:106532394-106532416 TCCCCTCCTCACACCTGGCCTGG - Intergenic
1032448026 7:132001361-132001383 GACCCTCATCATCCCTTGCCTGG - Intergenic
1033486095 7:141790493-141790515 TAACCTCATTATCCTGGGCCTGG + Exonic
1034550191 7:151815460-151815482 TACCCAAATCACCCCAGGGCAGG + Intronic
1041314192 8:56544566-56544588 TTCCCTAATCACCCCAGGGCAGG + Intergenic
1049230161 8:141477746-141477768 TGCCCGCCTCACCCAGGGCCTGG + Intergenic
1055250227 9:74294523-74294545 TACCCTAATCACCCAGGGCCAGG + Intergenic
1056081808 9:83102782-83102804 TGTCCTCATCACCCCAGGGCAGG - Intergenic
1056681779 9:88725441-88725463 TACCCCAATCACCCCAGGGCAGG - Intergenic
1056816941 9:89808793-89808815 AAGCCTCATCACCCAGGGCCTGG + Intergenic
1060191739 9:121598395-121598417 CACACCCCTCACCCCGGGCCTGG + Intronic
1060600473 9:124874017-124874039 TTTCCTCATCAGCCAGGGCCAGG - Intronic
1060917138 9:127398018-127398040 TGCCGTCATCACCGCGGCCCAGG + Exonic
1061679306 9:132235102-132235124 TACCTTCCTGACCCCTGGCCTGG - Intronic
1186649279 X:11541347-11541369 TGCCCTAATCACCCCAGGCCAGG - Intronic
1189387751 X:40551218-40551240 TGCCCTGCTCTCCCCGGGCCAGG - Intergenic
1190221027 X:48512372-48512394 TACCCACCTCGCCCCGGTCCAGG - Exonic
1196917793 X:120556713-120556735 TACCCTCATAATCTTGGGCCAGG - Intronic
1199675885 X:150189028-150189050 TTCCCTCAACAGCCCAGGCCTGG + Intergenic