ID: 935333855

View in Genome Browser
Species Human (GRCh38)
Location 2:101997256-101997278
Sequence CACCCCGCTGTGCCTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935333850_935333855 11 Left 935333850 2:101997222-101997244 CCTCAGTTGTCAGAGCCAGTGCT 0: 1
1: 0
2: 0
3: 18
4: 236
Right 935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 308
935333852_935333855 -4 Left 935333852 2:101997237-101997259 CCAGTGCTCCATCCGAGGTCACC 0: 1
1: 0
2: 2
3: 6
4: 106
Right 935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 308
935333849_935333855 24 Left 935333849 2:101997209-101997231 CCGAGGTCTGGTGCCTCAGTTGT 0: 1
1: 0
2: 1
3: 12
4: 169
Right 935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 308
935333848_935333855 25 Left 935333848 2:101997208-101997230 CCCGAGGTCTGGTGCCTCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935333855 Original CRISPR CACCCCGCTGTGCCTCTCCC TGG Intronic
900227892 1:1541197-1541219 CACTCCGCTGTGGCTGTCCCTGG + Intergenic
900494190 1:2969091-2969113 CACCCCTCTCTGCCCCTCCCAGG + Intergenic
900525319 1:3125662-3125684 CATCCCTCAGTGGCTCTCCCAGG + Intronic
900660211 1:3778332-3778354 CACCCTGCTGGGCCCCTGCCTGG - Intergenic
901109868 1:6785709-6785731 CACCCCGCCGGCCCCCTCCCCGG - Intronic
901417583 1:9128429-9128451 AGCCCCGCTGTGCCTGCCCCAGG - Intronic
903168014 1:21534609-21534631 CCCACCGCTGTCCCTCACCCTGG + Intronic
903846296 1:26281458-26281480 GGCCCCGCAGTCCCTCTCCCAGG + Exonic
904831827 1:33310319-33310341 CTCCCCGGTCTCCCTCTCCCCGG - Intronic
904831837 1:33310349-33310371 CTCCCCGGTCTTCCTCTCCCTGG - Intronic
905647094 1:39632646-39632668 CACCCCTCTGTGTTTCTTCCTGG + Exonic
906612820 1:47214958-47214980 CTCCCAGGTGTGCCTCTCCCTGG - Intergenic
907237328 1:53061664-53061686 GACCCTGCTGGGCCTCTTCCCGG - Intergenic
907819870 1:57956537-57956559 CACCCTTCTGTGCCTGCCCCAGG - Intronic
912269247 1:108192650-108192672 CACCCCGCTGGGGCTCACTCAGG - Intronic
912386752 1:109274630-109274652 CTGCCCGCACTGCCTCTCCCAGG + Exonic
913969855 1:143406505-143406527 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914064229 1:144232099-144232121 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914114921 1:144734255-144734277 TACCCCGCTGTGGCTCTACCAGG - Intergenic
914839526 1:151236719-151236741 CACCCCGTCGAGCCTCTCCCTGG - Exonic
915012040 1:152696619-152696641 CACGCTGCTGTGCTTGTCCCTGG + Intergenic
916680367 1:167098609-167098631 AACCCCACTGTGCCTCATCCAGG - Intronic
918290422 1:183102119-183102141 GACCCCGCTTTGTCTCTCTCTGG - Intronic
919991030 1:202708996-202709018 CGCCCTGCGGGGCCTCTCCCAGG - Intronic
920054366 1:203181746-203181768 CACCTCCCTGTGCCACTCCAGGG + Intronic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
920208869 1:204313817-204313839 CACCCCACAGAGCATCTCCCCGG + Intronic
920512245 1:206559838-206559860 CACCCAGCCCTGCCCCTCCCTGG - Intronic
920555072 1:206898766-206898788 CTGCCCTCTGTGCCCCTCCCTGG + Intronic
920879837 1:209869604-209869626 AACCCAGCTGAGGCTCTCCCAGG - Intergenic
922321619 1:224493529-224493551 CTCCCCTCTCTGCCACTCCCAGG - Intronic
922785108 1:228278731-228278753 CACACCGCGGTGCTTCTCCATGG - Exonic
923193232 1:231640822-231640844 CACCACGCTGTGCCCCTCCCTGG + Intronic
923546007 1:234923765-234923787 AACCCCTCAGTGGCTCTCCCTGG + Intergenic
924032116 1:239896126-239896148 CACTTCACTGTGTCTCTCCCAGG - Intronic
924800895 1:247329273-247329295 CACCCAGCTCTGGATCTCCCGGG + Exonic
1063123042 10:3118019-3118041 CACCAGACTGTGCCCCTCCCTGG - Intronic
1063400326 10:5737524-5737546 CGGCCCTCTGTGCCTCCCCCAGG + Intronic
1064007353 10:11709218-11709240 CACTCCTCTGAGCCTCTTCCAGG - Intergenic
1064208770 10:13347219-13347241 CACCCCGCTGACCGGCTCCCCGG - Intronic
1065561501 10:26968492-26968514 AACCTCGCTGTGATTCTCCCAGG + Intergenic
1065639487 10:27767371-27767393 CACCCCACTGTGCCTCATTCAGG + Intergenic
1065837517 10:29672428-29672450 CACACCGCTGTGCTTCAGCCTGG + Intronic
1067713926 10:48672181-48672203 CCCCGCGCAGGGCCTCTCCCAGG + Intergenic
1069720305 10:70545360-70545382 CTCCCCGCCCTCCCTCTCCCTGG - Intronic
1069961468 10:72081630-72081652 CAGCCCTCCGTGCCTATCCCTGG - Intronic
1070696525 10:78568056-78568078 CACACAACTGTGCCTCTCCAGGG - Intergenic
1071288662 10:84172493-84172515 CACCCTGATGAGCCTCTGCCTGG - Intergenic
1071503410 10:86219129-86219151 CAGCCCTCTGTGCCGCTCCCTGG + Intronic
1071794571 10:88990951-88990973 CGCCCCACTTTGCCTATCCCCGG - Exonic
1072290488 10:93960433-93960455 CACCCCGTCGAGCCTCTCCCTGG + Intergenic
1072727914 10:97825892-97825914 CATCCCGTTCTGCCTCTCACTGG - Intergenic
1073009204 10:100346900-100346922 CCCGCCGCTGGGCCTCTGCCCGG - Intergenic
1073337973 10:102724977-102724999 CACCCCTCAGTTCCTCTCACAGG - Intronic
1073738688 10:106381655-106381677 CACCCCGCCCTGTCTCTCTCTGG - Intergenic
1074149328 10:110744279-110744301 CACCCTGATGTGACTCTCCTGGG + Intronic
1074156879 10:110807455-110807477 CAGCCCGCTCTGCCCCTCACTGG + Intronic
1075223431 10:120603763-120603785 CATGCTGCTGTGCCTCTGCCTGG + Intergenic
1075347773 10:121696905-121696927 AACCCAGCTGTGCCACTCACTGG - Intergenic
1075801719 10:125159013-125159035 CACGCCGCTGGGCCTCCCGCGGG + Intronic
1075868121 10:125745124-125745146 CATCCTGCTCTGCCTCACCCAGG - Intronic
1076529766 10:131136478-131136500 CCCCCAGCAGTGCCTCGCCCAGG + Intronic
1076699872 10:132265835-132265857 CTCGCTGCTGTCCCTCTCCCTGG - Intronic
1076754689 10:132563070-132563092 CACCTCGCAGTCCCTCTGCCTGG - Intronic
1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG + Intronic
1076821884 10:132943521-132943543 CTCCCAGGTGGGCCTCTCCCGGG - Intergenic
1076821901 10:132943566-132943588 CTCCCAGGTGGGCCTCTCCCAGG - Intergenic
1076821912 10:132943601-132943623 CTCCCAGGTGGGCCTCTCCCGGG - Intergenic
1076821929 10:132943646-132943668 CTCCCAGGTGGGCCTCTCCCAGG - Intergenic
1076821955 10:132943726-132943748 CTCCCAGGTGGGCCTCTCCCAGG - Intergenic
1076921989 10:133459090-133459112 CACCCCTCTGTGCCACCCACTGG + Intergenic
1077046024 11:545518-545540 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1077046035 11:545571-545593 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077251030 11:1560805-1560827 CTCCTCCCTGTGGCTCTCCCAGG + Intronic
1077301372 11:1848667-1848689 CATCCCGCAGCGCCCCTCCCTGG - Intergenic
1077866942 11:6230208-6230230 CCCTCCTCTTTGCCTCTCCCAGG - Intronic
1078063189 11:8061414-8061436 CACCCTGCGGTGCCTCTACAGGG + Intronic
1078565277 11:12409009-12409031 CATCCCCCTCGGCCTCTCCCAGG - Intronic
1078611590 11:12824427-12824449 CACCCAGCTATGCCTCTTGCTGG + Intronic
1079042080 11:17068244-17068266 CACCCAGCTGGGCCCCTCTCAGG - Intergenic
1082026929 11:47579183-47579205 CACGCCGCTGCGCCTGACCCCGG - Intronic
1083347398 11:62003205-62003227 CAGCCCACTGTCCCTGTCCCTGG + Intergenic
1083611863 11:64008197-64008219 CTCCACGCTTTGCCTCTCCCTGG - Intronic
1083743526 11:64723117-64723139 CCCGCCGCGGTGCCTCTCCGAGG + Exonic
1083747163 11:64742942-64742964 ACTCCCGCTCTGCCTCTCCCGGG - Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1083954185 11:65974026-65974048 CACACCCATGTCCCTCTCCCTGG - Intronic
1083968564 11:66058211-66058233 CATCCCTCTGTCCCTTTCCCTGG + Intronic
1084149298 11:67280818-67280840 CACCCTGCTGCTCCTCTCCCGGG + Intronic
1084271142 11:68029820-68029842 CACCACGCCGGGCCTTTCCCCGG - Intergenic
1084361381 11:68670384-68670406 CACCCCGCCCTGCCTCTTGCTGG + Intergenic
1084608344 11:70185486-70185508 CACCAAGCTGAGCCTCTCCCAGG + Intronic
1084666070 11:70577039-70577061 CACGCCGCTGTCTCCCTCCCTGG + Intronic
1084959141 11:72707129-72707151 AACCCCGCCATGCCTCTGCCTGG + Intronic
1085523164 11:77149957-77149979 CAGCCCCCTCTTCCTCTCCCTGG + Intronic
1089346947 11:117796891-117796913 CTCCCCGCTGCGCCCCACCCGGG + Intronic
1089396136 11:118137204-118137226 CCCAGCCCTGTGCCTCTCCCTGG + Intronic
1090398912 11:126436016-126436038 CACCCCTCCGTGCCCCTCCAAGG + Intronic
1090732785 11:129586150-129586172 CATCCCACTTTGCCTCTCCTTGG - Intergenic
1091115463 11:133008530-133008552 CTCCCAGCTGAGCCTCTCTCTGG + Intronic
1092075054 12:5665863-5665885 CACCCCCCTGTGCCACTGGCTGG + Intronic
1096103916 12:48985777-48985799 CACCCCACCCTGCCCCTCCCAGG - Intergenic
1096124814 12:49111257-49111279 CACCCCGCTTTCCCGCTGCCAGG + Intergenic
1096655912 12:53092033-53092055 CACCTCTCTGTCCCTCCCCCAGG + Intergenic
1096715398 12:53488085-53488107 CACACCCCTGGGCCTCTCCAAGG + Intronic
1098241091 12:68467924-68467946 CACCACACTGTGGCTCTTCCAGG + Intergenic
1101131909 12:101698217-101698239 CGCGCGGCTGAGCCTCTCCCGGG + Intronic
1101404534 12:104416331-104416353 TACCATGCTGTGCCTCACCCAGG - Intergenic
1101677503 12:106931777-106931799 CATCCCTCTGTGCCTCCCACTGG + Intergenic
1101814662 12:108136751-108136773 CTCCCCGCTCTGTCTTTCCCAGG + Intronic
1102019467 12:109671679-109671701 CATCCAGCTATGCCACTCCCAGG + Intergenic
1102240964 12:111324436-111324458 CACCACGCCCTGCCTCTTCCTGG - Intronic
1102295983 12:111737020-111737042 CACCCCGCAGTGGCTCTTCAGGG - Intronic
1102739346 12:115193099-115193121 CACCTCCCTGTGCCTAGCCCCGG - Intergenic
1104845360 12:131844174-131844196 CACACAGCTGTGCGTTTCCCAGG - Intronic
1105000368 12:132686900-132686922 CACCCCGCAGGGCCTGGCCCGGG + Intronic
1105792940 13:23820670-23820692 CACCTGGCTCTGCCTCTCCCAGG + Intronic
1106248411 13:27967073-27967095 CACCCCGCGGCCGCTCTCCCGGG + Intronic
1108003703 13:45927156-45927178 GACCCAACTGCGCCTCTCCCAGG - Intergenic
1112228076 13:97560175-97560197 CACTTGGCGGTGCCTCTCCCTGG - Intergenic
1112372379 13:98805033-98805055 CACCCCGCCCTGCCTCTTCCCGG + Exonic
1113338263 13:109397473-109397495 CTCCCCGCAGTGCTTCTACCAGG - Intergenic
1115757754 14:36546337-36546359 CTCCCCTCTGTACCTCTTCCTGG + Intergenic
1117329079 14:54694840-54694862 CACCCAGCTGTGCCGGTACCTGG + Intronic
1118461171 14:65988614-65988636 CACCTCGCTTTTCTTCTCCCAGG + Exonic
1118768251 14:68924551-68924573 CAGCCCGCGGTGCCTCTCCAGGG - Intronic
1119079086 14:71675203-71675225 CACACCGCTGTGACGCTCTCAGG + Intronic
1119774271 14:77238871-77238893 CACCCCGGGGTGGCTCTCCCTGG + Intronic
1120999930 14:90444217-90444239 CAGCTCTCTGTGCCTCTCCAGGG + Intergenic
1121123832 14:91393257-91393279 CTCCCAGCTCAGCCTCTCCCGGG - Intronic
1121221201 14:92286774-92286796 CACACCGCTGGACATCTCCCTGG - Intergenic
1121660205 14:95629419-95629441 TACCCAGCTATGCTTCTCCCTGG + Intergenic
1123008071 14:105333909-105333931 CACCTGCCTGTGCCTCACCCGGG + Intronic
1124022817 15:25939579-25939601 CACCCCACTGTTTCTGTCCCGGG - Intergenic
1124929782 15:34108249-34108271 CACCACGCTGGGCCTCTTCTTGG + Exonic
1124983245 15:34583223-34583245 CACCGCGGTGAGCCCCTCCCGGG + Intronic
1126885847 15:53148916-53148938 AACCCAGCTGTAGCTCTCCCAGG + Intergenic
1127628298 15:60801671-60801693 CACCGTGGCGTGCCTCTCCCGGG - Intronic
1128226412 15:66004383-66004405 CCCCCCTCTGTGCCCCTCCCTGG - Intronic
1128809856 15:70562935-70562957 CACCCCCCTTTGCCTCACCATGG + Intergenic
1129515035 15:76152189-76152211 CACCCCCATGTGCCTTGCCCTGG + Intronic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1132483996 16:180900-180922 CACCCCGCCGGGGCCCTCCCGGG - Intronic
1132546558 16:535945-535967 CACCCTGCTGTCCCTCGGCCTGG + Intronic
1134182152 16:12056428-12056450 CACTCCGCTGTGTCTTCCCCAGG - Intronic
1136040726 16:27576759-27576781 CAACCCTCTGTGCCTTACCCAGG + Intronic
1136401493 16:30021665-30021687 CGCCCCGCTGCGCCTTTCCTAGG + Intronic
1136995893 16:35187907-35187929 CACCCAGCTGGGCTTCCCCCTGG + Intergenic
1138381810 16:56607895-56607917 CACCCTGCTCTGCCACTCACTGG + Intergenic
1138545851 16:57719040-57719062 CACCCCGCTCTGCAACCCCCTGG + Intronic
1140473430 16:75227132-75227154 CACCACGCGGTGGCTCTTCCTGG - Intergenic
1141297662 16:82784785-82784807 CACCCTGCTGTGCATCTGCCTGG - Intronic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1143482941 17:7237965-7237987 CACCCCACCGTACCGCTCCCGGG + Intronic
1143714424 17:8756754-8756776 CACCCAGCTGTGACTATCTCAGG - Intronic
1144848735 17:18233452-18233474 CTCCCCGCTGAGCCCCTCCTAGG - Intronic
1145937378 17:28722701-28722723 GACCCCATTTTGCCTCTCCCAGG + Exonic
1146126833 17:30237238-30237260 CATCCCCCTGCACCTCTCCCAGG - Intergenic
1146399695 17:32493341-32493363 CAGCCTCCTGTGCCTCACCCAGG - Exonic
1146673301 17:34756660-34756682 CTGCCTGCTGTGCCTCTCCCTGG - Intergenic
1147186130 17:38713907-38713929 CACCCTGCACTGCCCCTCCCGGG - Intronic
1147469887 17:40648928-40648950 CAGCCCTCTGTGCCACTCCAGGG + Intergenic
1147585318 17:41651162-41651184 CTCCCAGGTGGGCCTCTCCCAGG - Intergenic
1147980357 17:44270148-44270170 CAAGCTGCTGTGCCTCTGCCTGG - Intergenic
1148636927 17:49156162-49156184 TTCCCCACTGTCCCTCTCCCTGG + Intronic
1148847893 17:50539934-50539956 ATCCCAGCTCTGCCTCTCCCTGG + Intronic
1150618414 17:66789998-66790020 CTCCCCATTGTGCCTCTGCCCGG + Intronic
1150747101 17:67825340-67825362 CACCGCGCTGTGCCGAGCCCAGG + Intergenic
1151554171 17:74838145-74838167 CACCACGCAGGGACTCTCCCAGG - Exonic
1151569067 17:74917196-74917218 CACCCTGTTCTGCCTGTCCCAGG + Exonic
1151791331 17:76307726-76307748 CACGCCCCTGCGCTTCTCCCGGG + Intergenic
1152287649 17:79422037-79422059 CTCCCCTCTCTGCCCCTCCCTGG - Intronic
1152355823 17:79806685-79806707 CACCCCGCTGTCCCTCACTGGGG - Intergenic
1152541797 17:80980276-80980298 CACCCCGCTGTCCTTCTATCTGG + Intergenic
1152593980 17:81229349-81229371 ACCGACGCTGTGCCTCTCCCTGG - Exonic
1156424413 18:36994226-36994248 TACTCCTCTGTGCCTGTCCCTGG + Intronic
1156651577 18:39232991-39233013 CACCCCACTCAACCTCTCCCAGG + Intergenic
1157596782 18:48869031-48869053 CACCCGGCTGAGCCTTGCCCTGG - Intergenic
1158011835 18:52737584-52737606 CTCCCCGCTGTACCTATTCCAGG - Intronic
1160427000 18:78785021-78785043 CGCACCGCTGTGCCTCAGCCTGG - Intergenic
1160563961 18:79775522-79775544 CATCCCGCTCTGCCCCACCCAGG - Intergenic
1160684125 19:425529-425551 CACCCCGCCCTGGCCCTCCCCGG + Intronic
1161010033 19:1955511-1955533 CACCCCGCGGAGCCTCACCCTGG - Intronic
1161088346 19:2345231-2345253 CTCCGCCCTGTGCCTCCCCCAGG + Exonic
1161138139 19:2632908-2632930 CACCCGCCTGGGCCTCTGCCTGG + Intronic
1161266396 19:3366645-3366667 GTCCCCGCTCTGCCTCACCCAGG + Exonic
1161495672 19:4584542-4584564 CGCCCCGCTGTGTGACTCCCGGG + Intergenic
1161850778 19:6737116-6737138 GACCCCGCTGTGCGGCTCCAGGG + Intronic
1161883085 19:6971297-6971319 CTCTCTGCTGTGCCTCTTCCTGG - Intergenic
1162097944 19:8321889-8321911 CACTCCGCGGTGCCTTTCCGCGG + Intronic
1162392654 19:10398820-10398842 CACCCGGCTGTGCCACTGACGGG + Intronic
1162758812 19:12876106-12876128 CACCCCGTTGCTCCTCTCCCTGG + Exonic
1162817810 19:13207192-13207214 CTCCCGGCTGGCCCTCTCCCGGG + Exonic
1163241178 19:16064777-16064799 CACCCCGCTCTGCCACAACCAGG - Intergenic
1164686447 19:30169415-30169437 CAGCCTCCCGTGCCTCTCCCGGG - Intergenic
1164797514 19:31045948-31045970 CACCCACCTGTGCCTCTCACTGG + Intergenic
1165403958 19:35618800-35618822 CTCCCTGCAGTGTCTCTCCCTGG + Intronic
1165722808 19:38091607-38091629 CACCCTGCCCTGCCACTCCCTGG - Intronic
1166170748 19:41026157-41026179 CACCCCTGCGTTCCTCTCCCAGG - Intergenic
1167121625 19:47520800-47520822 CAACACGCTGGGCCCCTCCCTGG - Exonic
1168328257 19:55549819-55549841 ATCCCAGCTCTGCCTCTCCCTGG - Intergenic
926315166 2:11704391-11704413 TACCCCGCTCTGCCTCCCCCGGG - Intronic
926339851 2:11895897-11895919 CACCACACTGGGCCTCTCCTGGG + Intergenic
927179354 2:20433467-20433489 CTCCCCCTTGTGCCTCTTCCGGG - Intergenic
928144544 2:28760558-28760580 CACCTCACTGTGCATCTCTCAGG + Intronic
928170596 2:29000716-29000738 CCACCTGCTGAGCCTCTCCCTGG + Intronic
928606328 2:32947536-32947558 CCCCCAGCCGTGCCTCCCCCGGG + Exonic
929583749 2:43101031-43101053 CACCCCGCCGCTCCTCCCCCCGG + Intergenic
931090077 2:58876316-58876338 TCCCCAGCTGTGCCTCTTCCAGG + Intergenic
933086611 2:78061235-78061257 CACTTCACTGTCCCTCTCCCAGG - Intergenic
933237680 2:79882981-79883003 CACCCTGCTCTTCCTCTCCGTGG + Intronic
933759780 2:85665506-85665528 TTCCCGGCTCTGCCTCTCCCAGG + Intronic
934174547 2:89567418-89567440 TACCCCGCTGTGGCTCTACCAGG + Intergenic
934284863 2:91641768-91641790 TACCCCGCTGTGGCTCTACCAGG + Intergenic
934567781 2:95350109-95350131 CTCGCCCCTGTGGCTCTCCCTGG + Intronic
934656732 2:96120306-96120328 CACCATGCTGTGACTCTGCCTGG + Intergenic
934992774 2:98933147-98933169 GTCCCCGCTGTGGCTCACCCTGG + Intronic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
936306554 2:111348245-111348267 CAGCCTGCTGTCCCTCCCCCTGG + Intergenic
937298304 2:120823089-120823111 CACCCGGCTGTGTGTTTCCCAGG + Intronic
937975738 2:127581185-127581207 CACCCCGCAGGGCTTCTCCGGGG + Intronic
937997076 2:127702107-127702129 CACCGCGCTGCGCCTCGCACTGG + Exonic
938669272 2:133571518-133571540 CACCCAGCCGTCCTTCTCCCAGG - Intergenic
943266484 2:185738818-185738840 CACCCCGTTGTCCCTCTGTCCGG - Exonic
944927990 2:204485029-204485051 GCCCCCGCTGTCCCTCTACCTGG + Intergenic
946520749 2:220461872-220461894 CACACTGCTGTGCATCTCACTGG - Intergenic
947787552 2:232837214-232837236 CACACCGATGTGCTTTTCCCAGG + Intronic
948287492 2:236797637-236797659 CACACAGCTGGGCCTCTCCAGGG - Intergenic
948690115 2:239696746-239696768 AACCCCGCTCTGCCTCCCCAGGG + Intergenic
948718301 2:239880502-239880524 CACCCCTCAGTGCCTCACCCTGG + Intergenic
1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG + Intronic
1171456738 20:25276577-25276599 CCGGCCCCTGTGCCTCTCCCCGG - Intronic
1171467019 20:25336864-25336886 CACCCCCCTGGGCATCTGCCTGG - Intronic
1172116239 20:32575042-32575064 CACCTCACTATGCCTCTGCCTGG + Intronic
1172174087 20:32961722-32961744 CACCCCACTGGGCCTCTCTGGGG + Intergenic
1172190651 20:33060083-33060105 CACCCATCTGGGCATCTCCCAGG + Intronic
1172227783 20:33316774-33316796 CTCCCAGCTCTGCCTCTCCTAGG - Intergenic
1172644624 20:36461819-36461841 CCGCCCGCTTTGTCTCTCCCCGG + Intronic
1174049476 20:47757800-47757822 CCCGCTGCTGTTCCTCTCCCTGG - Intronic
1174082808 20:47983063-47983085 CCCCCTGCTGTTCCTCACCCAGG - Intergenic
1174133148 20:48359919-48359941 CTCCCTGCTGTTCCTCACCCAGG + Intergenic
1174732662 20:52933083-52933105 CACCCTGCTGAGCCTCTCTTTGG + Intergenic
1176169595 20:63690871-63690893 CAGCCCCCTGGGCCTCTGCCGGG - Exonic
1176364832 21:6026526-6026548 CAGCCCCCTGTGCCTCACCCCGG + Intergenic
1177550822 21:22620009-22620031 CACACCGCTGTGGCTTTCCAAGG - Intergenic
1179758686 21:43512019-43512041 CAGCCCCCTGTGCCTCACCCCGG - Intergenic
1179929406 21:44557541-44557563 CACCCGGCCCGGCCTCTCCCTGG - Intronic
1180166266 21:46031800-46031822 CACCCAGCTCTTCCTCTCCTAGG - Intergenic
1181773057 22:25140633-25140655 GACCCCGAGGTGCCCCTCCCAGG - Intronic
1182443114 22:30375633-30375655 CACCCTGCTGGGCCACTTCCCGG - Exonic
1182678049 22:32055567-32055589 CACCCCACTGTGCCCCTTCAGGG + Intronic
1183107631 22:35626236-35626258 AACCCTTCTGTGGCTCTCCCTGG - Intronic
1183393853 22:37560707-37560729 CACCCGGGGGCGCCTCTCCCGGG - Intronic
1183431028 22:37765826-37765848 CAGCCCACTGTGCCCCCCCCAGG - Intronic
1184274942 22:43404861-43404883 CTCACTGCGGTGCCTCTCCCAGG + Intergenic
1184802554 22:46770349-46770371 CAGCCAGCTGTGCCCCTTCCGGG - Intronic
1184943185 22:47783424-47783446 CACCACGCCCGGCCTCTCCCAGG + Intergenic
1185017430 22:48352877-48352899 CACCTCGCTGTGGCTCTCTGAGG - Intergenic
1185110606 22:48898190-48898212 CCACCCGCTCTGCCCCTCCCTGG + Intergenic
1185148582 22:49152004-49152026 GTCCCCGCTGTGGCTGTCCCAGG - Intergenic
1185233787 22:49699590-49699612 CACCCCGCTGAGCCTGGCCTGGG - Intergenic
1185275961 22:49950349-49950371 CACCCCTCTGTGCTTCCCCGTGG - Intergenic
1185280167 22:49966553-49966575 CACCGCCCTGAGCCTCTCTCAGG + Intergenic
960088472 3:113615207-113615229 CTCCCCTCTGAGCCTCTCTCTGG - Intronic
961166492 3:124767084-124767106 CAGCCCGCTAACCCTCTCCCAGG - Intronic
963106630 3:141653114-141653136 CACACCCCTGTGCCTTTCCAAGG + Intergenic
963430571 3:145196957-145196979 CACCACACTCTCCCTCTCCCAGG - Intergenic
963888127 3:150603525-150603547 CACCCCGCCGCGCCTCTGCTCGG + Intronic
964032197 3:152151702-152151724 CACCCTGCAGTGCCTCTGGCAGG + Intergenic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
967973914 3:195020299-195020321 CACTCTGCTGTTCCTCTCCCGGG + Intergenic
967978165 3:195046807-195046829 CACCCCACTGTGCCTTTCCCAGG - Intergenic
968434152 4:576320-576342 CAGCCCGCGGGGCCCCTCCCAGG + Intergenic
968850390 4:3074264-3074286 CTCCCTGCTGTGCCCCGCCCCGG + Intergenic
969394098 4:6909647-6909669 CGCCCGGCTGTCCCTCTTCCGGG - Intronic
973861645 4:55070691-55070713 CACCCCGATCAGCCTCTACCAGG + Intergenic
974016821 4:56655889-56655911 CACCACGCTGTGCCTCATCGCGG - Exonic
983807202 4:172009420-172009442 CTACCCCCTGTGCCTGTCCCTGG + Intronic
983934659 4:173493020-173493042 CTCTCCCCAGTGCCTCTCCCTGG + Intergenic
985708731 5:1416162-1416184 CACCCAGGTGTGCTTCTCCCTGG - Exonic
985715804 5:1460441-1460463 TACCCTGCTGTGCACCTCCCTGG + Intronic
985918576 5:2948110-2948132 CACCCTGGTGTGCCTTTCACTGG + Intergenic
988558755 5:32261359-32261381 CACCTTGCTGTTCCTCCCCCAGG + Intronic
989242294 5:39215499-39215521 CACCCTGCTGTGCTCCTCTCAGG + Intronic
991989351 5:72321750-72321772 CACTACACTGTGCTTCTCCCTGG + Intronic
995487773 5:112656546-112656568 CACCCAGCTAAGCTTCTCCCAGG - Intergenic
995724583 5:115169934-115169956 CGCCCCGCGGTGCCCCGCCCAGG - Intronic
997471711 5:134120893-134120915 CACCTCCCTGGGCCCCTCCCTGG - Intronic
999672024 5:153966322-153966344 CACTCCCCTGGGCCCCTCCCAGG + Intergenic
1000360157 5:160439427-160439449 CAACCCCCTGTGCCACTCCGGGG - Intergenic
1001081540 5:168671269-168671291 CACCACGCTGTCCTTCTCCACGG + Exonic
1001122827 5:168994138-168994160 CACCCAGCTGTCCCACTCCAGGG - Intronic
1001563351 5:172684196-172684218 CACCCCGCTGCGCTCTTCCCCGG + Intronic
1002204358 5:177553061-177553083 CAGCCCTCTGTGCCTCCCTCTGG - Intronic
1003653870 6:7987601-7987623 CGCCCAGCCGAGCCTCTCCCTGG - Intronic
1003989285 6:11469960-11469982 GGCCCTGCTGTGCCTCTCCCTGG + Intergenic
1004462189 6:15848013-15848035 GTCCCAGCTGTGCCTCTTCCTGG - Intergenic
1007178563 6:39912646-39912668 CACCCCTCTCTGCCACTTCCTGG + Intronic
1007322610 6:41038474-41038496 AGCCCCACTGGGCCTCTCCCAGG + Intronic
1007423140 6:41731633-41731655 GACCCCACTGTGCCTCTCACTGG - Intronic
1008447462 6:51609740-51609762 CACTCCTATGTGCCTTTCCCAGG - Intergenic
1009366385 6:62860861-62860883 CACCCCTCTCTCCCCCTCCCTGG - Intergenic
1011293358 6:85800570-85800592 CACTTAGCTGAGCCTCTCCCAGG + Intergenic
1013075147 6:106764555-106764577 CACCCAGCTGTGTCTCTCTCTGG - Intergenic
1014798083 6:125748483-125748505 CACCCCGCTGTGCGTCTGCGAGG - Intronic
1015781323 6:136869283-136869305 CACCCCACTGTACCTCAGCCTGG - Intronic
1017503504 6:155046746-155046768 GATCCCTCTGTGCCTCTCTCGGG + Intronic
1018613115 6:165662381-165662403 CACCTCCCCGTGCGTCTCCCAGG - Intronic
1019261876 7:86392-86414 CAGCCCCCTGAGCCTGTCCCCGG + Intergenic
1019611899 7:1940972-1940994 CACCCTCCTCTTCCTCTCCCAGG + Intronic
1019893771 7:3967147-3967169 CCCTCCACTGTTCCTCTCCCAGG - Intronic
1024198309 7:47081653-47081675 CATGCAGCTCTGCCTCTCCCTGG - Intergenic
1030566388 7:111163313-111163335 CACCCCTCAGTGCCAGTCCCTGG + Intronic
1032020546 7:128405336-128405358 CACCTGGCTGGGCCTCTCCTGGG + Intronic
1033098835 7:138453624-138453646 CACCCCCCACTGCCACTCCCTGG + Intergenic
1034421504 7:150993391-150993413 CACCCCTGTGTGCCTTTCCCTGG - Intronic
1035354814 7:158270659-158270681 TACCTGGCTGTCCCTCTCCCTGG + Intronic
1035599813 8:890927-890949 CACCCGGCTGTGCCCCTTACTGG + Intergenic
1036214109 8:6864898-6864920 CTCCCCTCTGGGCCTTTCCCAGG - Intergenic
1037468532 8:19184599-19184621 CAACCTGCTGAGCATCTCCCTGG - Intergenic
1038499134 8:28028902-28028924 ATCCCAGCTGTGCATCTCCCTGG + Intronic
1038695568 8:29803654-29803676 GACCCAGCTTTGCCTGTCCCCGG + Intergenic
1040445929 8:47493621-47493643 CAGGCTGCTGGGCCTCTCCCAGG - Intronic
1045354428 8:101372806-101372828 CAGCCTGGTGTGGCTCTCCCAGG - Intergenic
1046631086 8:116623741-116623763 CTTCCCACTGTGCATCTCCCTGG - Intergenic
1049373559 8:142278849-142278871 CCCCACGCTGTGCCTCACTCTGG - Intronic
1049381846 8:142320091-142320113 CAGCCTCCTGTCCCTCTCCCTGG + Intronic
1051770412 9:20572195-20572217 CACCCCTCTGTCCCTGCCCCTGG - Intronic
1052094992 9:24373243-24373265 AACCACGCTGTGCCTGTCACTGG - Intergenic
1057258107 9:93567247-93567269 CACAACGCTGTCCCTCTGCCAGG - Intergenic
1057433907 9:95021842-95021864 CTTCCCACTGAGCCTCTCCCTGG - Intronic
1057791556 9:98128177-98128199 CATCCCGCTGAGCCACTCCTGGG + Exonic
1059325608 9:113502434-113502456 GACCCCTCTGGGCATCTCCCTGG - Intronic
1060813503 9:126623149-126623171 CACCCTTCTGTTCCTCACCCAGG + Intronic
1061919653 9:133775925-133775947 CACCCTGCTGGGCCGCTCACAGG + Intronic
1061991146 9:134159381-134159403 CAGCCAGCTCTGCCTCTCTCAGG + Exonic
1062076519 9:134592870-134592892 CACCCAGCCCAGCCTCTCCCAGG - Intergenic
1062122344 9:134840568-134840590 CAGCCAGCTGCACCTCTCCCAGG - Intronic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1062396541 9:136355078-136355100 CACCCGGCTACCCCTCTCCCAGG - Intronic
1062439786 9:136564521-136564543 CTGCCCGCTGTGCCCCTTCCTGG - Intergenic
1185449663 X:275585-275607 CACCCCGCTGTCTCCCACCCCGG - Intergenic
1186313445 X:8344333-8344355 CACACCGCTGTGCTCCACCCTGG + Intergenic
1186505621 X:10089747-10089769 CACCCAGCTCTGCCACTCACTGG - Intronic
1187337636 X:18394766-18394788 CACCCCGCTGTCGGTTTCCCAGG + Intergenic
1188524165 X:31071551-31071573 CCCCCAGCTGTGCCACTTCCTGG - Exonic
1201762730 Y:17557677-17557699 CACCCCTCTGTGCCTTCCTCTGG - Intergenic
1201838822 Y:18348312-18348334 CACCCCTCTGTGCCTTCCTCTGG + Intergenic