ID: 935334429

View in Genome Browser
Species Human (GRCh38)
Location 2:102002254-102002276
Sequence GACATAGACATATTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935334429 Original CRISPR GACATAGACATATTTTCTCC TGG (reversed) Intronic
905244662 1:36604280-36604302 GACAGACTCATATTGTCTCCAGG + Intergenic
907226838 1:52955682-52955704 AACCTAGACAAATTTTCTTCTGG + Intronic
907760166 1:57349923-57349945 GACATAGACACATTTATTCCTGG + Intronic
908072058 1:60471677-60471699 ACCACAGACATGTTTTCTCCAGG + Intergenic
908107885 1:60864655-60864677 GAAAGAGAAATATTTTTTCCTGG + Intergenic
910779480 1:90913342-90913364 GACATATACATAACTTCTCAAGG - Intergenic
913324361 1:117613829-117613851 GACTTAGAAATGTTTTCTCTGGG + Intronic
915690819 1:157688655-157688677 TATATAGCCATATTTTCACCTGG - Intronic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
918980393 1:191550391-191550413 TCCATAGACATAATTTTTCCAGG - Intergenic
918993211 1:191725408-191725430 CACATATACATATTTTCTAATGG + Intergenic
919410074 1:197231882-197231904 GACATAGACATCTTTGGTCGAGG - Intergenic
920776551 1:208943682-208943704 GAGAAAAACATATTTTCTCCTGG - Intergenic
921680681 1:218027278-218027300 GATAGAGACACATTTTCTGCGGG + Intergenic
924048527 1:240056996-240057018 CAAATAGAGATATTTTTTCCTGG - Intronic
1064702981 10:18040888-18040910 GACACAGTCAAATTTTCTCTGGG - Intronic
1068358995 10:55951622-55951644 TATATAGAAATATTTTTTCCTGG - Intergenic
1069193685 10:65521826-65521848 TACATATACATATTTTCCCGTGG + Intergenic
1069624100 10:69856790-69856812 GACCTAGAGATATCTTCTCAAGG - Intronic
1071001398 10:80834903-80834925 GACATTGACATACTTTTACCTGG + Intergenic
1071117482 10:82238980-82239002 GTCATAAAGATATTTTCTCATGG + Intronic
1071117540 10:82239709-82239731 GTCATAAAGATATTTTCTCATGG + Intronic
1071801989 10:89073775-89073797 GAAATTGCCACATTTTCTCCTGG - Intergenic
1075576305 10:123580240-123580262 GATATAGACATTTTTTCTGGCGG + Intergenic
1077644351 11:3910219-3910241 GACATGGTCAAATTTCCTCCTGG + Intronic
1078143907 11:8710334-8710356 GACAGAGACATACCTTCTCTGGG - Intronic
1079600781 11:22310939-22310961 GTCATAGATATTTTTTCTCCCGG - Intergenic
1080759407 11:35233628-35233650 GAGCTAGGCATATGTTCTCCAGG + Intergenic
1085866511 11:80301088-80301110 TACATAAACACATTTTCTGCTGG - Intergenic
1087260879 11:96010752-96010774 GACAGAGAAATATTTTTGCCTGG + Intronic
1090434031 11:126671502-126671524 GATTTACAAATATTTTCTCCTGG - Intronic
1091866366 12:3840859-3840881 GACAAAGACACATGTTCTGCTGG - Intronic
1093926702 12:24915779-24915801 TAAATAGATATATTTTCTACAGG + Intronic
1095223680 12:39652231-39652253 GACATATACTTCATTTCTCCTGG + Intronic
1095463069 12:42462495-42462517 GAAATAGACATAATTTGGCCAGG - Intronic
1095647959 12:44571738-44571760 GACATAGATATTTTTTCTTGGGG + Intronic
1095968675 12:47886201-47886223 CACACAGGCATATCTTCTCCTGG - Intronic
1098132963 12:67369715-67369737 CACATAGACATATTTGCTGTTGG + Intergenic
1099563770 12:84214252-84214274 GGCAGAGAAATATTGTCTCCTGG - Intergenic
1100786085 12:98080114-98080136 GACTTGGACATATTTTCTGGGGG - Intergenic
1101458783 12:104867037-104867059 GTCAGATACATATTTTCTTCCGG - Intronic
1104253131 12:127115523-127115545 GACATCCAAATATTTTATCCAGG + Intergenic
1104780883 12:131419552-131419574 GACATAGACATATCTTTTTGGGG + Intergenic
1111948232 13:94687918-94687940 GACATTGCCAAATGTTCTCCTGG + Intergenic
1113240053 13:108327526-108327548 GCCAGAGACTTATTTTCTCATGG + Intergenic
1115780610 14:36764338-36764360 GACACAGACACAGTTTCTACTGG - Intronic
1116270468 14:42758569-42758591 CACTTAAACATATTTTCTCATGG + Intergenic
1116974174 14:51096789-51096811 GACATAGATAAAATTTCTTCAGG + Intergenic
1120698220 14:87668105-87668127 GATGGAGACATATTTTCACCAGG + Intergenic
1202912416 14_GL000194v1_random:131202-131224 GACATAGAAAGAGTTTGTCCAGG + Intergenic
1123915376 15:25019848-25019870 GACAAAGACATCTTTCCTGCAGG + Intergenic
1124413591 15:29456656-29456678 GGTTTATACATATTTTCTCCAGG - Intronic
1126361017 15:47846155-47846177 GCCATAGGCTTGTTTTCTCCTGG - Intergenic
1128964713 15:72047171-72047193 GAGATAGACATATATTTTCAAGG + Intronic
1130237455 15:82149515-82149537 GACACAGACATGTTCTCTACTGG + Intronic
1130622385 15:85477239-85477261 GGCATAGAGAGATTTTCTCAGGG + Intronic
1133035599 16:3032385-3032407 GACTTAGAGATATTGTGTCCAGG - Intronic
1133512078 16:6469398-6469420 CACATAGACAAGTTTTCTCCAGG + Intronic
1134414948 16:14034982-14035004 GACATAGACATACCCTCCCCGGG - Intergenic
1135780581 16:25296587-25296609 GACATAGTCACATTTTCTCAGGG + Intergenic
1136082738 16:27862906-27862928 GAAATAAACATATATTCTCTAGG + Intronic
1139152318 16:64397399-64397421 GATATAGACTTACTTTCTCAAGG - Intergenic
1140983324 16:80132679-80132701 GACCTCCAAATATTTTCTCCTGG + Intergenic
1141117348 16:81321016-81321038 ATCAAAGACATATTTTATCCAGG + Intronic
1141198830 16:81882113-81882135 GAAATAGACCTCTTTTCCCCAGG + Intronic
1147941038 17:44048179-44048201 AACATAGAAAAATTTTTTCCAGG + Intronic
1156761904 18:40602676-40602698 GACATACAAATATTTTCTGAAGG + Intergenic
1157342292 18:46790124-46790146 AACTTGGACATAATTTCTCCTGG + Intergenic
1158193586 18:54859050-54859072 GAAATTGCCATATTTTTTCCTGG + Intronic
1158226521 18:55206960-55206982 GACTTAGACATATAGTCTCAGGG + Intergenic
1159213125 18:65355160-65355182 TACATAGATATATTTTGTCGTGG - Intergenic
1159650996 18:70978772-70978794 GACATAGAAATATTTCACCCAGG + Intergenic
1166671530 19:44712725-44712747 GAAATAGACAGACTTTCTGCAGG + Intergenic
1167495263 19:49814046-49814068 GAAATAGACATACTTTTTCATGG - Intronic
1168035510 19:53716179-53716201 CACATACACAAATATTCTCCAGG - Intergenic
1168312914 19:55470245-55470267 AACAGAAACTTATTTTCTCCCGG - Intergenic
926860919 2:17307883-17307905 GACATAGCCAAATTTTCTCAAGG - Intergenic
932762496 2:74448007-74448029 GAAATAAAAATATTTTATCCAGG + Intergenic
933461422 2:82591881-82591903 GACAGAGGAATATTGTCTCCTGG + Intergenic
935334429 2:102002254-102002276 GACATAGACATATTTTCTCCTGG - Intronic
935546777 2:104408092-104408114 CACATAGCCATATTTTCTAAAGG + Intergenic
936862949 2:117039811-117039833 GATTTACAAATATTTTCTCCCGG - Intergenic
939860953 2:147419844-147419866 TACAGATACATATTTTCTCATGG + Intergenic
940954854 2:159716024-159716046 ATCATAGTCATATTTTCTCATGG + Intronic
941125825 2:161581870-161581892 GAAATACTCATATTTTATCCAGG + Intronic
941413132 2:165185609-165185631 CACAGAGACATATTTACCCCTGG + Intronic
942719415 2:178933908-178933930 CACATAGACATAGTGACTCCTGG - Intronic
945203170 2:207305272-207305294 ACCATAGACACCTTTTCTCCTGG + Intergenic
945440600 2:209874646-209874668 GTCATAAACAGATATTCTCCAGG + Intronic
947157134 2:227173918-227173940 TACATAGACATATGCTGTCCAGG - Intronic
948445008 2:238025786-238025808 GCCATCTACATTTTTTCTCCTGG - Intronic
1170305795 20:14936431-14936453 GACATAGAAACATTTTCAGCAGG - Intronic
1170925172 20:20716097-20716119 GACATAGACATATCTTTTTGGGG - Intergenic
1172507299 20:35472961-35472983 GACATAGGCAGATTTACTCTGGG - Intronic
1173383896 20:42570934-42570956 GACATAGACATTTTTTATCGGGG + Intronic
1174518846 20:51114248-51114270 GACATAGACATATCTTTTTGGGG + Intergenic
1175625845 20:60487643-60487665 GACATAGACATAGGGTCTGCAGG + Intergenic
1177587433 21:23116482-23116504 TAGATAGACATATTTGCTCAGGG + Intergenic
1179766944 21:43581568-43581590 AACACAGATAAATTTTCTCCAGG + Intronic
1182814550 22:33148987-33149009 GATTCAGACATATTTTTTCCTGG + Intergenic
1182821730 22:33222424-33222446 GATATAGACATATTTTTTGTGGG - Intronic
1184757656 22:46526051-46526073 GACATAGACCTCTTGTCCCCGGG + Intronic
949399152 3:3647574-3647596 AACAGAAACGTATTTTCTCCAGG + Intergenic
949876054 3:8626702-8626724 GAAAGGGACATCTTTTCTCCTGG + Intronic
951203874 3:19904788-19904810 GACATAGACATATCTTTTTGTGG + Intronic
951415734 3:22419321-22419343 ATCATAGACAGATTTTCTCCTGG + Intergenic
951729691 3:25796892-25796914 GACATAATCATATTTTCTTTTGG + Intergenic
952564486 3:34638490-34638512 AACATAGACATTATTTCTCTTGG + Intergenic
952815805 3:37446619-37446641 GAAATACACATAGTTCCTCCAGG - Intergenic
953235787 3:41104785-41104807 GCCATACACATATTATCTCCTGG - Intergenic
953358796 3:42277108-42277130 GACATACAAATATTTTGCCCTGG + Intergenic
956204642 3:66742525-66742547 GACATTGCCAAATGTTCTCCAGG + Intergenic
956711606 3:72043016-72043038 GAAAAAGACATGTTTCCTCCTGG + Intergenic
957060594 3:75478302-75478324 GACATAGGCACATGTTCTCTGGG - Intergenic
957182293 3:76894764-76894786 TAGATAAACATGTTTTCTCCAGG - Intronic
958053430 3:88379393-88379415 GATTAAGACATATTTTCTACAGG + Intergenic
958209070 3:90445012-90445034 GAAAAGGAAATATTTTCTCCTGG - Intergenic
958711868 3:97726433-97726455 GAAATATAAATATTTTCTGCAGG + Intronic
959121650 3:102240182-102240204 GACTTAGAAGAATTTTCTCCAGG - Intronic
967629394 3:191726925-191726947 GCCAAAGAAATATTTTCTGCAGG - Intergenic
968787423 4:2633088-2633110 GACATAGAAATAATTTCTTGTGG + Intronic
970318288 4:14850732-14850754 GACATTGACTTTCTTTCTCCTGG - Intergenic
974012815 4:56623148-56623170 GACATAGCCATTTTCTCTCTAGG + Intergenic
974658071 4:64850366-64850388 GACATTGACATATGTTCACAGGG + Intergenic
977645616 4:99408131-99408153 ATCATAGACATAGTCTCTCCTGG - Intergenic
978693228 4:111541774-111541796 AACATAGAAATATTTTCTTGAGG + Intergenic
978784407 4:112593543-112593565 GACATAGACATAGAGTCTTCAGG - Intronic
979918523 4:126470202-126470224 GTCTTATACATATCTTCTCCTGG - Intergenic
980097458 4:128506337-128506359 CACTTTGATATATTTTCTCCCGG + Intergenic
980102124 4:128552250-128552272 GACATACACAGACTTTCTGCCGG + Intergenic
980874675 4:138648899-138648921 GACATTTACATATTTTATCCTGG - Intergenic
981253845 4:142637319-142637341 GACATAGACAATTTTTTTGCGGG - Intronic
981261379 4:142723917-142723939 GACATAAACGTCATTTCTCCTGG + Intronic
981471679 4:145142309-145142331 GACAAAGACACATGTTCTGCTGG + Exonic
983671882 4:170247081-170247103 GACATAGGCCTGTCTTCTCCTGG + Intergenic
984325956 4:178251042-178251064 GACATATATATATTTTATACGGG - Intergenic
984882997 4:184426592-184426614 GATGTGGACATATCTTCTCCGGG + Intronic
985496083 5:207062-207084 GACATTCAATTATTTTCTCCCGG + Intronic
986271608 5:6235967-6235989 GATAAAGACATTTATTCTCCAGG - Intergenic
987806168 5:22771730-22771752 GACATAGACATATTTTGTAAGGG - Intronic
987948342 5:24644643-24644665 GACATAGTGACAATTTCTCCTGG - Exonic
987973630 5:24982516-24982538 AATACAGACATATTTTCTACAGG - Intergenic
994658237 5:102620977-102620999 GACATAAACATATTATTTCCTGG - Intergenic
997025571 5:130056877-130056899 AACATATACATATTGTTTCCAGG - Intronic
998934754 5:147223138-147223160 GACAAAGCCTTATTTTCTGCTGG - Intergenic
1000581732 5:163041953-163041975 GACATTGACAAATGTTCTCAAGG + Intergenic
1000649239 5:163795758-163795780 GAATTAGACATATCTTCTCATGG - Intergenic
1001243672 5:170089400-170089422 GAGATAGACATTTATTCTCCTGG - Intergenic
1002802614 6:539526-539548 GACTTAGGCATCTCTTCTCCAGG - Intronic
1003647068 6:7921402-7921424 GACATACCCGGATTTTCTCCAGG + Intronic
1003763533 6:9209916-9209938 GAGATAGAAATTTTTTCTTCTGG - Intergenic
1004148078 6:13088834-13088856 CACATGGAAATATTTCCTCCTGG + Intronic
1005151522 6:22757051-22757073 GGCAGAGAAATATTATCTCCTGG + Intergenic
1006414590 6:33895947-33895969 GCCATAGGCATGTTTTCTTCTGG + Intergenic
1008583501 6:52927880-52927902 AACATAGATATTTTTTATCCAGG - Intergenic
1009424018 6:63494248-63494270 GCCATAGAAATAATTTCTTCTGG - Intergenic
1009977405 6:70686327-70686349 AACAAATACATATTTTCTCTTGG + Intronic
1010169120 6:72954091-72954113 GACATAGACATATTCTTACGTGG - Intronic
1010457762 6:76078283-76078305 CACATAGACATATGCTCTGCAGG + Intergenic
1010573009 6:77500760-77500782 GACCTCAACATATTGTCTCCTGG - Intergenic
1010786605 6:80009317-80009339 GTCATATAATTATTTTCTCCAGG - Intronic
1010850129 6:80764691-80764713 CACATTGACAGATTTTCTCCTGG - Intergenic
1010984604 6:82409462-82409484 GAGAGAGATAAATTTTCTCCTGG - Intergenic
1011191044 6:84728641-84728663 GAGATGGACATATTATATCCTGG - Intronic
1012234264 6:96795007-96795029 TAAATAGATATATTTTCTACAGG + Exonic
1012331319 6:97991694-97991716 TATATTGACATATTTTCTTCAGG + Intergenic
1014732544 6:125050413-125050435 CACACAGACAGAGTTTCTCCAGG - Intronic
1014863591 6:126501074-126501096 GACAAAGCCATATTTTCTTCAGG + Intergenic
1018511447 6:164528580-164528602 GACATAGACATCTTTGGTGCAGG + Intergenic
1019045762 6:169144307-169144329 AAAATAGGGATATTTTCTCCTGG - Intergenic
1023267419 7:38421896-38421918 GAAATAGAAATAGTTACTCCTGG - Intronic
1023887014 7:44365726-44365748 GATTTACAAATATTTTCTCCTGG - Intergenic
1024032694 7:45477662-45477684 GACTTAAAAATATTTTCTCCAGG - Intergenic
1024580247 7:50794957-50794979 TACATAGACATATGTTCTTTTGG + Intergenic
1027813615 7:82939678-82939700 GATATAGATATATTTTCCACTGG + Intronic
1031356149 7:120789487-120789509 GACATAGACATACATTCTGTGGG + Intronic
1031636329 7:124105546-124105568 TACATGCAAATATTTTCTCCAGG - Intergenic
1034487981 7:151378030-151378052 GATTTAGATATATTTTCTCCAGG + Exonic
1034934954 7:155193074-155193096 GACAAAGATAGATTCTCTCCAGG + Intergenic
1037024712 8:14020437-14020459 TACATAAACATTTCTTCTCCTGG + Intergenic
1040787005 8:51177939-51177961 GGTTTAGAAATATTTTCTCCAGG - Intergenic
1041738435 8:61134872-61134894 GACATAGACATCTTTGCTGGGGG + Intronic
1041861439 8:62517876-62517898 GATATAGATATAGTTTCTCCAGG - Intronic
1045037485 8:98187043-98187065 GACATGGACATATTGTTTCAGGG + Intergenic
1046477806 8:114770744-114770766 GGGATATACAAATTTTCTCCAGG - Intergenic
1048089457 8:131223034-131223056 GACAAAGACATCATCTCTCCTGG + Intergenic
1050108501 9:2190684-2190706 GACATAAACATTTTTTTTCCTGG + Intronic
1050773032 9:9227381-9227403 GACCTGGAGATATTTTCTCCAGG - Intronic
1051308631 9:15744470-15744492 TACACAGAGAGATTTTCTCCAGG + Exonic
1052452324 9:28647540-28647562 GAAAATGACATATTTTTTCCTGG + Intronic
1052923903 9:33997136-33997158 CTCCTAGACATATTTTCTCAAGG + Intronic
1052946811 9:34175227-34175249 GGCAAAGACATCTTTTCTCCTGG - Intergenic
1054836373 9:69678449-69678471 CACATAGTCATAATTTCTTCTGG - Intergenic
1055044742 9:71912006-71912028 GACCTGGACATGTTGTCTCCTGG + Intronic
1055122087 9:72672324-72672346 GAAATATAAATATTTTCTCATGG + Intronic
1055752510 9:79522531-79522553 GACATAGAAACACTTTCTCTAGG - Intergenic
1056204472 9:84306672-84306694 CTCATAGACATCTGTTCTCCAGG - Intronic
1056313651 9:85368181-85368203 GACCAAGACAAATCTTCTCCTGG + Intergenic
1056672686 9:88644579-88644601 GATTTGAACATATTTTCTCCTGG + Intergenic
1057816875 9:98302483-98302505 GAAATAAACATATTTTCTCTGGG + Intronic
1058237038 9:102503032-102503054 GACATTGTCAAATGTTCTCCAGG - Intergenic
1058478515 9:105366548-105366570 GAAATAGACATACTTTATCAAGG - Intronic
1060115353 9:120935986-120936008 GACACACACATAGTATCTCCCGG + Intergenic
1186524456 X:10235683-10235705 GCAAAATACATATTTTCTCCAGG + Exonic
1188025467 X:25203731-25203753 GATATAAACATATTTTCTCTTGG + Intergenic
1188065994 X:25660078-25660100 GATATGCACATATTTTATCCCGG + Intergenic
1188856505 X:35202548-35202570 CATATAGACATATGTTCTTCGGG - Intergenic
1193872311 X:86814950-86814972 AACACAGACATATTTTGTCCAGG + Intronic
1194656280 X:96577740-96577762 AAGGTAGACATATTTCCTCCAGG - Intergenic
1197333516 X:125182430-125182452 GACACAGACATCTTTTCGGCGGG + Intergenic
1197710658 X:129664723-129664745 GACATAGACATATCTTTTCGGGG + Intergenic
1199346231 X:146744785-146744807 GTCTTAAAAATATTTTCTCCTGG + Intergenic
1199660712 X:150047542-150047564 GACATAGACATATTACCACCAGG + Intergenic