ID: 935335528

View in Genome Browser
Species Human (GRCh38)
Location 2:102012302-102012324
Sequence CTCTGAAGCCAGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935335528_935335532 13 Left 935335528 2:102012302-102012324 CCTTCCACCAGCTGGCTTCAGAG 0: 1
1: 0
2: 0
3: 18
4: 319
Right 935335532 2:102012338-102012360 TAAACTCATTTGACTTAAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 190
935335528_935335533 25 Left 935335528 2:102012302-102012324 CCTTCCACCAGCTGGCTTCAGAG 0: 1
1: 0
2: 0
3: 18
4: 319
Right 935335533 2:102012350-102012372 ACTTAAGAAGGACTGTACCCAGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935335528 Original CRISPR CTCTGAAGCCAGCTGGTGGA AGG (reversed) Intronic
900486260 1:2924214-2924236 GCCCGAAGCCAGCTGGTGGGAGG - Intergenic
900764482 1:4494744-4494766 CTCTGTGGCCACCTGGTGGCTGG - Intergenic
900809495 1:4790631-4790653 CTCTGAAGCCAGAGGGTGAAAGG + Exonic
901097577 1:6694506-6694528 CTCTGAAGTCAGCTTGGGGAAGG - Intronic
902564864 1:17304745-17304767 CTCTCAGGCTAGCTGGGGGATGG + Intergenic
902628070 1:17688424-17688446 CTCTGAAGCCAGCTGGGGTGAGG - Intronic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
905129037 1:35738490-35738512 GTCAGAAGCCAGGTGGAGGAAGG - Exonic
908395875 1:63725281-63725303 GTCTGAAGTCACCTGGGGGATGG - Intergenic
910510535 1:87999224-87999246 ATCTGTGTCCAGCTGGTGGAAGG + Intergenic
911412868 1:97532489-97532511 CTGTGAAGCCACCTGGTCGTAGG + Intronic
912857346 1:113181718-113181740 CTGTGAATCCATCTGGTGCAGGG - Intergenic
912903160 1:113674541-113674563 CTCTGATGCCTACTGGTGGCAGG - Intronic
913501613 1:119477214-119477236 CTCTGAAGGCAACTGAAGGAAGG - Intergenic
914859513 1:151374440-151374462 CTCTACAGCCAGCAGGTGGTTGG + Intergenic
914954708 1:152151007-152151029 CACTGAAGCCAGATCATGGAGGG + Intergenic
915942846 1:160129795-160129817 CCCTGAGGCCAGGTGGTGGTGGG + Intronic
916060709 1:161096804-161096826 ATCTGAATCCAGCTGTTGGGAGG + Intergenic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918302714 1:183218762-183218784 ATTTGGAGCCAGCTGGTGGGAGG - Intronic
918709172 1:187705419-187705441 CTCTGAAGGCTGCTTGTTGAAGG + Intergenic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
920889677 1:209971996-209972018 CTGTGAATCCATCTGGTGCAGGG + Intronic
921512539 1:216050134-216050156 CTTTTAAGCCATTTGGTGGAAGG - Intronic
921549750 1:216520672-216520694 CTCAGAAGCCATGAGGTGGATGG - Intronic
922663772 1:227451906-227451928 CTCTGCAGTCAGCAGGTGGAGGG + Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
923617937 1:235553152-235553174 ATCTGAAGCCTGCTGGCGCATGG + Intronic
924037878 1:239954765-239954787 CTCTGAAGTCTGCTGGTGCGTGG - Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924569036 1:245221033-245221055 CTCTGACACCAGCTGAGGGAAGG - Intronic
924920175 1:248620671-248620693 CTCTGAAGCCTGCTTGTTGGAGG + Intergenic
1063153167 10:3355125-3355147 CTCTGAAGGCAGGGGGTGGCTGG - Intergenic
1063642332 10:7842280-7842302 CTGTGATCCCAGCTGGTGGTAGG - Intronic
1063718681 10:8556300-8556322 GTCTGAAGCCAGCTTGTATAGGG - Intergenic
1067750685 10:48969291-48969313 CTCTGCCTCCAGCTGGAGGAAGG - Intronic
1069837916 10:71320706-71320728 CCCTGGAGCCAGCAGGTGGGGGG - Intronic
1070832530 10:79427993-79428015 ATCTAAAGCAAGCTGATGGAAGG + Intronic
1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG + Intronic
1073097012 10:100985996-100986018 CCCTTGAGCCAGCTGGTGGGGGG - Intronic
1073751359 10:106531078-106531100 CACTGAAGTTAGCTGTTGGAGGG - Intergenic
1075903765 10:126063636-126063658 TTCTGCAGCCAGCAGGAGGAGGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076497441 10:130906155-130906177 CTCTGGACTCAGCAGGTGGAAGG - Intergenic
1076653081 10:132003543-132003565 CTCTGCACTCAGCTGGTGGGAGG + Intergenic
1076909547 10:133380053-133380075 CTCAGCAGCCAGCTGGAAGACGG - Exonic
1077092850 11:787540-787562 CCCTGAAGCCTGCGTGTGGAGGG - Exonic
1077394859 11:2315812-2315834 GCAGGAAGCCAGCTGGTGGAGGG - Intronic
1077452847 11:2661378-2661400 ATGTGAAGCCAGCTGTTGGAGGG + Intronic
1077486254 11:2839628-2839650 GGCTGGAGCCAGCTGGGGGAGGG + Intronic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1077798404 11:5514949-5514971 CTCTGTGGCCAGCAGCTGGAGGG + Exonic
1078340460 11:10495069-10495091 CTCTGAAGGCAGATGTTGGGAGG - Intronic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1079739076 11:24035407-24035429 ATCTGAAGACACCTGTTGGAAGG + Intergenic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1081836588 11:46160414-46160436 CACTGCTGCCAGCAGGTGGAGGG - Intergenic
1082729335 11:56775764-56775786 CTCTGCATCCAGCTAGTGGTGGG - Intergenic
1084085354 11:66852637-66852659 CTCTGAAACCAGCCGGGGGCGGG + Exonic
1084476828 11:69394083-69394105 CTCGGAAGCCGGCTGCTGGGAGG + Intergenic
1084952876 11:72676393-72676415 CACTCAAGCAAGCAGGTGGAAGG + Intergenic
1086351421 11:85945695-85945717 GTCTGAGGGGAGCTGGTGGATGG - Intergenic
1086967990 11:93050046-93050068 CCCTGAAGCAAACTGGTGAAAGG + Intergenic
1087863629 11:103196051-103196073 CAGTGAAGCCAGATTGTGGAGGG + Intronic
1088989209 11:114937215-114937237 CTCAGAATGCAGTTGGTGGAGGG - Intergenic
1089279736 11:117365431-117365453 CCCTGCTGTCAGCTGGTGGATGG + Intronic
1090407414 11:126485317-126485339 CTCTGAAGTCAGCTAGTTCAGGG - Intronic
1091763164 12:3101063-3101085 GTCTGAAGTCATCTGGAGGAGGG + Intronic
1091841757 12:3626621-3626643 CCATGAATCCTGCTGGTGGAAGG + Intronic
1092407320 12:8230117-8230139 CTCAGGAGCCAGCTCCTGGATGG + Intergenic
1093336338 12:17910005-17910027 CTCTGTAGGCAACTGGTGGTTGG + Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095800237 12:46264766-46264788 CTCAGAAGCCAGAGGTTGGAAGG - Intronic
1097101717 12:56594400-56594422 CTCTGAAGCCTGCTGATTCAGGG - Exonic
1102191487 12:110992048-110992070 GGCTGAAGCCAGCTGGCTGAAGG - Intergenic
1103351577 12:120287402-120287424 CTCTGGAGCCAGTGGGTGGGAGG + Intergenic
1104229896 12:126874562-126874584 CTCTGAGGCCAGCAGGTGCCTGG + Intergenic
1104304336 12:127595710-127595732 CACTCAAGACAGCTGGTGGGTGG + Intergenic
1104554168 12:129785102-129785124 CACTGATCCCAGCTGGTGCAAGG - Intronic
1105402032 13:20104738-20104760 CTCTGCAGCCAGCCTGTGGGGGG - Intergenic
1110267631 13:73556331-73556353 ATCTGAAGTCAGCAGGTGGGGGG + Intergenic
1111172159 13:84541553-84541575 CTCTGAAGCCAGCTACCTGAAGG - Intergenic
1111791058 13:92855889-92855911 CTGTGAATCCATCTGGTGCAAGG - Intronic
1113890192 13:113731542-113731564 CCCTGAGGCCTGCAGGTGGAGGG + Intronic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1116219757 14:42068195-42068217 CTATGAATCCATCTGGTGTAGGG + Intergenic
1116858832 14:49977693-49977715 CTCTCAGGCCAGATGCTGGATGG + Intergenic
1116965352 14:51009090-51009112 CACGAAATCCAGCTGGTGGATGG + Exonic
1116985355 14:51213553-51213575 CTCTGCATCCAGCTGGCGAATGG - Intergenic
1117485368 14:56191564-56191586 GTCTGCAGCCAGCTGCTGGAAGG + Intronic
1118359530 14:65044359-65044381 CGCTGCAACAAGCTGGTGGATGG + Exonic
1119471682 14:74904311-74904333 CTCTGAAGCCTGCTGGCTGGAGG - Exonic
1120796690 14:88641140-88641162 CTCTGAATCCATCTGGTCCAGGG - Intronic
1121104562 14:91271969-91271991 CTCAGGAGCCAGCTGGAGGCTGG + Exonic
1121127386 14:91417213-91417235 CCCTGAGACCAGCCGGTGGATGG - Intronic
1121865194 14:97356310-97356332 CCCTGAAGCCAGGAGGTGCAAGG + Intergenic
1121889019 14:97572094-97572116 TTCTGAGGCAAGCTGGGGGATGG + Intergenic
1122225855 14:100278860-100278882 CTCTGAAGGCAGCCGGCTGATGG - Exonic
1123681224 15:22765636-22765658 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1124333435 15:28840098-28840120 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1124355476 15:28991960-28991982 CTCTGGGGCCAGCTAGAGGAAGG + Intronic
1125713454 15:41805357-41805379 TTCCTCAGCCAGCTGGTGGAAGG + Intronic
1130796976 15:87220028-87220050 ATCTGAAGCCAGAAGGTGTAAGG + Intergenic
1131511278 15:93050832-93050854 CTCTGAAGCGTGCTGGTGCCTGG + Intronic
1132689161 16:1174859-1174881 GTCTGCAGCCAGCTGGCGGTGGG + Intronic
1132868024 16:2103450-2103472 CTCTGAGGCCAGCCGCTCGATGG + Exonic
1133716274 16:8452349-8452371 CTCTCCATCCAGCTGGTGTAAGG - Intergenic
1133790848 16:9008284-9008306 ATCCTAAGCCTGCTGGTGGATGG + Intergenic
1134022518 16:10930876-10930898 CTCAGGAGCAGGCTGGTGGAGGG - Exonic
1134523749 16:14929674-14929696 CTCTGAGGCCAGCCGCTCGATGG - Intronic
1134549152 16:15131262-15131284 CTCTGAGGCCAGCCGCTCGATGG + Intronic
1134711340 16:16328159-16328181 CTCTGAGGCCAGCCGCTCGATGG - Intergenic
1134719191 16:16371461-16371483 CTCTGAGGCCAGCCGCTCGATGG - Intergenic
1134948236 16:18340424-18340446 CTCTGAGGCCAGCCGCTCGATGG + Intergenic
1134955489 16:18380534-18380556 CTCTGAGGCCAGCCGCTCGATGG + Intergenic
1136554998 16:31002314-31002336 CTCTGAGCCCTGCGGGTGGAGGG - Intronic
1138182858 16:54954475-54954497 CTCTGCAGCAAGCTGTGGGAGGG - Intergenic
1138205084 16:55118781-55118803 CTCAGAAGGCAGGGGGTGGAGGG - Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138412673 16:56852308-56852330 CTCTGAAGCCTTGTGGTGCAGGG - Intergenic
1138424531 16:56921972-56921994 GTCTGAAGTCAGCTTGGGGAAGG + Intergenic
1139313722 16:66049969-66049991 CTTTGAAGCAAGCAGATGGAGGG - Intergenic
1139680561 16:68558637-68558659 ATCGCAAGCCAGCTGCTGGAGGG - Intronic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1140671356 16:77282768-77282790 ATCAGAAGCCAGCTGTTGGTAGG - Exonic
1141437519 16:84008825-84008847 CTTTGAGTCCAGCTGGTGGGAGG + Intergenic
1141687641 16:85579389-85579411 TTCTGAAGCCAACTTGGGGAGGG + Intergenic
1144123266 17:12177590-12177612 TTCTTAAGCCAGATGGTGGTGGG + Intergenic
1147569018 17:41556036-41556058 CTCTGAAGCCAGTTTGTTAAAGG - Intergenic
1147886547 17:43688147-43688169 CTCTGAAGCCACTTGGTTTATGG - Intergenic
1148079507 17:44960006-44960028 CTCTGCAGCGAGCCGGTGGGAGG + Exonic
1149455677 17:56786185-56786207 CTCTGATGCCAGATGCTGGCTGG - Intergenic
1150063624 17:62090398-62090420 CTCTGAGGCCAGCTCTTTGACGG - Intergenic
1150816292 17:68394837-68394859 CTCTGCAGCCAGCTGTTGCCTGG - Intronic
1151853493 17:76705921-76705943 CTCAGAAGCCAAGTAGTGGAGGG - Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1152427199 17:80224838-80224860 CTCTGCAGCCATCTGGGGGGAGG + Intronic
1152611777 17:81318462-81318484 CTCTGGAGCCTGCCGGGGGAGGG - Intronic
1157184800 18:45529784-45529806 CTCTGAAGCCCTTTGGTGGGGGG + Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158195476 18:54880796-54880818 CCCTGAAGGCAGCTGCTGTATGG + Intronic
1158363353 18:56702091-56702113 ATCTGAAGAGAGCTGGTGAAAGG + Intronic
1158616864 18:58995881-58995903 CTCTGAAGCCAACTGGCAGCAGG + Intergenic
1158653786 18:59310226-59310248 CTCTAAAGCCAGCTAGGGGGAGG - Intronic
1158872982 18:61706852-61706874 CTCTGAAGACTGAAGGTGGAAGG - Intergenic
1159994793 18:74953758-74953780 GTCTGCAGCCAGCTGGTAAAAGG - Intronic
1160115554 18:76075761-76075783 CACTGTAGCCAGCTGATAGATGG - Intergenic
1160827608 19:1088066-1088088 CCCTGAAGCCAGCGCGAGGAGGG + Exonic
1160956494 19:1694895-1694917 CTCTGAAGGCTGATGCTGGAGGG + Intergenic
1163372133 19:16907169-16907191 CTCAGAAGCCAGTGGGTGGGTGG - Intronic
1163772050 19:19197192-19197214 CTGTGCTGCGAGCTGGTGGATGG - Exonic
1164536241 19:29088206-29088228 GTCTGAAGCCATCTTGGGGATGG + Intergenic
1164815879 19:31203177-31203199 CTATGCAACTAGCTGGTGGAAGG + Intergenic
1165007518 19:32818741-32818763 CGTTGTAGCCAGCAGGTGGAGGG + Intronic
1165045642 19:33102860-33102882 CTCTGAAGCTAGCAGGGGCAAGG + Intronic
1165912767 19:39239325-39239347 CTCTGAAGGCAGGAGGTGCAGGG - Intergenic
1167674909 19:50877935-50877957 CACTGAGGCCAGATGGAGGATGG - Intronic
1168072448 19:53960513-53960535 GTCTGAGGCCAGCTGATGGGGGG + Intergenic
1168593345 19:57654484-57654506 CTCTGAGGCCAGCTGGGCTAAGG - Intergenic
925275469 2:2645167-2645189 TTCTGAAGGCAGTGGGTGGAAGG - Intergenic
925509614 2:4610887-4610909 CTCTGAAGCCAGCTACCTGAAGG - Intergenic
926639974 2:15224735-15224757 CTCTGAAGGCCACTGGAGGAAGG + Intronic
930391181 2:50763611-50763633 CTCTCCAGCCAACTTGTGGAAGG + Intronic
930608965 2:53520684-53520706 CTTTGCAGCCTGCTGGTGGGAGG - Intergenic
931965890 2:67534218-67534240 TGCTTAAGCCAGCAGGTGGAAGG - Intergenic
932452917 2:71827282-71827304 CTCTTGAGCAAGATGGTGGAAGG - Intergenic
932862829 2:75312229-75312251 TGCTGAGGCCAGGTGGTGGAGGG + Intergenic
934884913 2:98016083-98016105 CTCTGGAGGCAGCTGGTTGTGGG + Intergenic
935200181 2:100849676-100849698 CTCTAAAGCAAGGTTGTGGAAGG + Intronic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
935378024 2:102420478-102420500 GTCTGAGGCCAGTTGGTGGGTGG + Intronic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
941056061 2:160790179-160790201 CTATTAAGCCAGCTGATGGTGGG - Intergenic
941452875 2:165680506-165680528 CTCTGGAGTCAGCTGAGGGAGGG - Exonic
942309826 2:174645713-174645735 CTTTGAAGACAGCTGGTCAAAGG - Intronic
942387367 2:175456536-175456558 CACTGAAGCCTGTTGGTGGCGGG + Intergenic
942555119 2:177164744-177164766 CTCTGGCGCCAGCTAGTGGTAGG - Intergenic
944173777 2:196806771-196806793 CTTTGAACCCAGGAGGTGGAGGG + Intronic
944539924 2:200745238-200745260 CTTTGAACCCAGGAGGTGGAGGG - Intergenic
946337178 2:219045729-219045751 CTCTAAGGCCAGCTGGTGTACGG - Intergenic
946407248 2:219498247-219498269 TTATTAAGCAAGCTGGTGGAGGG - Intronic
946607098 2:221417207-221417229 CTCTGAAGCCAGCTGTTCTTAGG + Intergenic
947314228 2:228837777-228837799 TTTTGAAGCCAGCTGGTGAAAGG - Intergenic
947983455 2:234428984-234429006 CTCTGAGGCCAAATGGTGGGAGG + Intergenic
948860378 2:240750017-240750039 CTCTGCAGCAGGCTGGGGGAGGG + Intronic
1171328173 20:24314255-24314277 CTCTAAAGCCAGGTGGGGCAGGG + Intergenic
1171339687 20:24417764-24417786 CTCAGAAACCAGTTGGTGGTGGG - Intergenic
1171452573 20:25246905-25246927 CTCTGAAGTCTGCAGCTGGAAGG + Intergenic
1172808733 20:37632065-37632087 CTCTCCAGCCAGCGGGTGAAAGG - Intergenic
1172864113 20:38082169-38082191 CTCTGAATCCATCTGGTCCAGGG + Intronic
1174758793 20:53186119-53186141 CTTTGATGTAAGCTGGTGGAAGG + Intronic
1175328417 20:58145883-58145905 CTCTCAAGCCAGCTCTTGGGAGG - Intergenic
1175339588 20:58219766-58219788 CTCTGCAGACAGCTGCTGGGGGG - Intronic
1176987002 21:15448829-15448851 CATGGAAGCCACCTGGTGGAAGG + Intergenic
1177274763 21:18895764-18895786 CTCTGAATCCAGCTGGAGCAGGG - Intergenic
1178082804 21:29082442-29082464 ATCTGCAGTCAGCTGGTGGGTGG + Intronic
1178513092 21:33223451-33223473 CTCTGAAGCCAGCTACTTGGAGG - Intergenic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1179446992 21:41438923-41438945 CTTTGAAGCCAGCTGGACCATGG + Intronic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182393974 22:30022097-30022119 CTCTGAAGCCAGCTGGGAGCAGG + Exonic
1182716457 22:32359691-32359713 CTCTAAGGCCAGGTGGAGGAGGG - Intronic
1184130084 22:42512464-42512486 ATCTCCAGCCAGCTGGAGGAAGG + Exonic
1184496902 22:44847199-44847221 CTCTGAAGCCAGCAGGGGCCTGG + Intronic
949487889 3:4557767-4557789 CTCAGAAGCCAGATGGGGGTAGG + Intronic
949620461 3:5805658-5805680 CTCTAAAGCCTGCTGGTGTTGGG + Intergenic
951541171 3:23783416-23783438 ATGAGAAGGCAGCTGGTGGAGGG + Intergenic
953110126 3:39927575-39927597 CTGTGAATCCATCTGGTGCAGGG - Intronic
954394498 3:50286399-50286421 GCCTGAAGCCACCTGGTAGAAGG + Intronic
954642386 3:52108861-52108883 CTTTGAAGCCTGCAGGGGGAGGG - Intronic
955056805 3:55462151-55462173 CTCTGCTCCAAGCTGGTGGAGGG + Intergenic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
956506718 3:69948362-69948384 CTCTGACGCTAGCTTGGGGAAGG + Intronic
956650497 3:71500476-71500498 TTCTGAAGCCAGCAGGATGATGG - Intronic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
957162256 3:76625225-76625247 CTCTCAAGCCAGCTTGTGTGTGG + Intronic
957305244 3:78449418-78449440 CTCTGAAGCCTGCTACTTGAAGG + Intergenic
958918086 3:100071877-100071899 CCCTGAAGACACCTGGTTGATGG - Intronic
958969740 3:100598896-100598918 TTCTGAAGGCAGCAGGTGGTTGG + Intergenic
959584064 3:108009422-108009444 TGCTGAAGCCAGCTGGTGATGGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960811278 3:121629684-121629706 CTCTGAAGGCAGCAACTGGAGGG - Exonic
962814374 3:138985113-138985135 CTCTGTCTCCAGCTTGTGGATGG - Intergenic
963842219 3:150119425-150119447 CTCTGAAGCCTGCTGTTCAAAGG + Intergenic
964386405 3:156152413-156152435 CTCTGAATCCAGCTGGTATCAGG - Intronic
965893014 3:173538297-173538319 CTCTGAAACCAGCTGCTTCAGGG + Intronic
967106738 3:186260597-186260619 CTCTGGAGCCCACTGGTGGCAGG + Intronic
967292147 3:187931673-187931695 TTCTGGAGCCTGATGGTGGAGGG - Intergenic
967852286 3:194091272-194091294 CCCTGAAGCCATCTGGAGGGTGG - Intergenic
969350301 4:6594437-6594459 CTGGGAGGGCAGCTGGTGGAGGG + Intronic
969543861 4:7811243-7811265 CTCCGCAGCCAGCGGGTTGAGGG - Intronic
970005829 4:11409821-11409843 GTATGAAGCCAGCTGGCTGATGG + Intronic
970251508 4:14121071-14121093 GTCCGAGGTCAGCTGGTGGATGG - Intergenic
971021259 4:22538443-22538465 TTTTGAAGCCAGGTGATGGATGG + Intergenic
971504712 4:27353713-27353735 CTTTGCAACCAGCTGGTTGATGG - Intergenic
972250382 4:37293652-37293674 TTATGAAACCAGATGGTGGATGG + Intronic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
974982879 4:68982205-68982227 CTCTTTTGCCAGCTGGTTGAAGG + Intergenic
978470004 4:109054992-109055014 CTCTGAATGTAGCTGGAGGATGG - Intronic
979913703 4:126404294-126404316 CTGCCAAGCCAGCTGGAGGAGGG - Intergenic
982670115 4:158310665-158310687 CTGTGAATCCATCTGGTGCAGGG + Intergenic
984867286 4:184292378-184292400 CCCTGATTCCAGCTGGTGGACGG - Intergenic
985018819 4:185665782-185665804 CTCTGACCCCAGGTGGGGGAGGG + Intronic
985117338 4:186605131-186605153 GTTTGAAGCCAGGAGGTGGAGGG + Intronic
985285167 4:188329749-188329771 CTCTGAAGCCTGCTGCCTGAAGG - Intergenic
986392213 5:7297630-7297652 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
986482889 5:8206339-8206361 TTCTGAAACCAGCTGCTTGAGGG - Intergenic
988485431 5:31664848-31664870 CTCTGCCCCCAACTGGTGGAAGG + Intronic
990006903 5:50954578-50954600 CTCTGAAGCCTGCTGCTTGAAGG + Intergenic
990561124 5:56984080-56984102 CTTTGAAGCCAGCTGTTGAAAGG + Intergenic
992516546 5:77499603-77499625 CTCTGGTGCCAGTTAGTGGAAGG - Intronic
993884959 5:93405274-93405296 CTCTGAATCCAGCTGGAAAATGG - Intergenic
994525638 5:100902110-100902132 CACAGAGGCCAGCGGGTGGAAGG + Intronic
995254642 5:110032498-110032520 ATCTGGAGACAGATGGTGGAGGG + Intergenic
997152027 5:131507547-131507569 CTCGGATGACAGCTTGTGGATGG - Intronic
997238750 5:132292059-132292081 CTCTGTAACCAACTGATGGAGGG + Intronic
997574440 5:134963242-134963264 CTCTGAAGCCAGTTCCTGGCTGG + Intronic
997933260 5:138089327-138089349 CTCAGAAGCCCGCGTGTGGAGGG - Intronic
998796931 5:145830415-145830437 CTCTGAATCCAGCTCATGAAAGG + Intronic
998986361 5:147762401-147762423 CGCTTAAGCCACCTGGTTGATGG - Intronic
999257657 5:150218682-150218704 CCCGGAAGGCAGCTGGTGCAGGG + Intronic
1000572142 5:162928116-162928138 CTCAGAAGCCAGCAGATGGAGGG - Intergenic
1000975820 5:167763135-167763157 TGCTGAAGGCAGCTGGTGCAAGG + Intronic
1002212310 5:177606256-177606278 CTCTGAGGCCACCACGTGGAGGG - Intronic
1002380098 5:178821041-178821063 CTGTGAATCCATCTGGTGCAGGG + Intergenic
1002381066 5:178830721-178830743 CTCAGATGCCAGCAGGAGGAGGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1002919300 6:1555045-1555067 CTCTGAAGCTGGATGGTGGCTGG + Intergenic
1003406414 6:5830180-5830202 CTCTGAAGGCTGTTGATGGATGG - Intergenic
1004265402 6:14144790-14144812 CTGTGCTGCCACCTGGTGGATGG + Intergenic
1005873698 6:29995739-29995761 CTCTATAGCTAGCTGGTGGAAGG + Intergenic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006501354 6:34461071-34461093 GTGTGAAGCCAGCTGGTGGGAGG + Intergenic
1006830289 6:36964184-36964206 GTCTGCAGCCAGCTGAAGGATGG - Intronic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1007254084 6:40516476-40516498 ATCTGAAGGCAGCTGGGGAAGGG + Intronic
1007699556 6:43758801-43758823 ATCTGAAGCCCACTGATGGAAGG + Intergenic
1009833810 6:68971944-68971966 CTCTGTGGCCCGCTGGTGGGAGG + Intronic
1009933117 6:70200214-70200236 CTTTGAATACAGCTTGTGGATGG + Intronic
1010722175 6:79295876-79295898 CTGTGAAACCATCTGGTGCAGGG + Intergenic
1010727867 6:79355759-79355781 CTCTGAAGGCAGGTGGTGCCTGG + Intergenic
1011300582 6:85868807-85868829 TTCTGCTTCCAGCTGGTGGAGGG + Intergenic
1014275745 6:119386397-119386419 CCCTGAGGCCTGCTGGGGGATGG + Intergenic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1014848931 6:126315967-126315989 CTCTGTAGTCAGCTGGGTGATGG + Intergenic
1018454091 6:163936771-163936793 CTCTGAAGCCTGCTGCAGGGAGG + Intergenic
1019442371 7:1053911-1053933 CTCTCAAACCAGCTCCTGGAGGG + Intronic
1021682325 7:23146354-23146376 CTATGAAGACAGCTGGCAGATGG - Intronic
1022764971 7:33401720-33401742 CTCTGAAGCCTGCTGCCTGAAGG - Intronic
1026739309 7:72968975-72968997 CCCTGAACCCTGCTGGTGGCAGG + Intronic
1026790334 7:73327590-73327612 CCCTGAACCCTGCTGGTGGCAGG + Intronic
1027104422 7:75396098-75396120 CCCTGAACCCTGCTGGTGGCAGG - Intronic
1028725821 7:94086534-94086556 ATCTTAAGCCAGCTGTGGGATGG + Intergenic
1029802871 7:102967941-102967963 CTGTGAAGCCAGCTGTTGTGGGG - Intronic
1031473857 7:122199335-122199357 ATCTGACTCTAGCTGGTGGAAGG - Intergenic
1031512121 7:122663918-122663940 CTCTGAACACATGTGGTGGAAGG - Intronic
1031810173 7:126357733-126357755 CACTGCAGTCTGCTGGTGGATGG + Intergenic
1031852471 7:126881624-126881646 CTCTGTAGCCTTCTGGAGGATGG + Intronic
1032246275 7:130216203-130216225 CTCAGAAGCCTCCTCGTGGAAGG + Exonic
1033532554 7:142279845-142279867 CTTTGCAGGCAGCTGGTGGCTGG - Intergenic
1036601523 8:10265192-10265214 CTCTGCAGCTGGCTGGAGGAGGG + Intronic
1037588450 8:20294363-20294385 CTGTGCAGCCGGCTGGTGGCTGG - Intronic
1038518809 8:28211282-28211304 CACTGGGGCCAGCTGGGGGAGGG + Intergenic
1039334013 8:36570243-36570265 CTCTGCAGCCAGTGGGTGGTGGG - Intergenic
1039831745 8:41220971-41220993 CTTTGAAGACAGGTGGTGAAGGG - Intergenic
1040899059 8:52399048-52399070 CTCTGAAGCCAACTGGTCCTGGG + Intronic
1041187207 8:55313608-55313630 CTTTCATGCCAGCTGGTTGATGG - Intronic
1041377502 8:57218345-57218367 CTCTGAAGGCAGCGTGTGAAGGG + Intergenic
1041976406 8:63803851-63803873 TTCTGATGCTAGCTGGTAGAGGG + Intergenic
1042621329 8:70708830-70708852 CTATGAAGCCATCTGGTCTAAGG - Intronic
1042965542 8:74348007-74348029 CTCTGAAGCAGGATGGAGGATGG + Intronic
1044907433 8:97019457-97019479 CTCTGAAGGCAGCAGATGGTTGG - Intronic
1047943052 8:129845280-129845302 CTTTGAAGCCAGCAAGTGGCAGG - Intronic
1048202884 8:132391476-132391498 CTCTGCACCCAGCAGGTGGCCGG + Intronic
1048509874 8:135052642-135052664 CTCTGAAGCCAGCTGAGGTTGGG - Intergenic
1048658174 8:136566649-136566671 CTCTGAAGGCAACTGGTACAGGG - Intergenic
1050634311 9:7594476-7594498 CTCTGAATCCACCTGGTCCAGGG + Intergenic
1053275833 9:36782679-36782701 CTCTGGAGGCAGCTGGTAGCAGG - Intergenic
1053291519 9:36882544-36882566 CTTTGAAGGCAGGTGGTGGCAGG - Intronic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1056601218 9:88048569-88048591 AGCTGAAGCCACATGGTGGAGGG + Intergenic
1057237587 9:93376212-93376234 CTGTGAAGCCATCAGGTGCAGGG + Intergenic
1057788229 9:98104659-98104681 CTTTGAAGAGAGCTGGTGGCTGG + Intronic
1059253542 9:112908589-112908611 CTCTTATGACAGCTGATGGAGGG + Intergenic
1059925884 9:119208721-119208743 CTCTCTAGGCAGCTGGTGGTTGG + Exonic
1061118677 9:128629967-128629989 CTCTGCAGCCATGTGGGGGATGG - Intronic
1061160018 9:128888349-128888371 CCCTGAACCCAGGTGGTGGGTGG - Intronic
1062432675 9:136532993-136533015 CTCTGCAGCTCTCTGGTGGACGG - Intronic
1186389309 X:9142915-9142937 TTCTGTACCCAGCTGATGGAAGG - Intronic
1187057334 X:15753432-15753454 CTCTGAAGCCTGCTACTGGGAGG - Intronic
1187529320 X:20082149-20082171 AACGGAAGCCAGCTGGTGGTAGG - Intronic
1190994044 X:55587147-55587169 TTGTGAAGCCAGCTGGTCGTGGG - Intergenic
1192196590 X:69032872-69032894 CTCTGGAGGCAGCTTGTGGCCGG + Intergenic
1193664048 X:84294084-84294106 CTATGCAGCCAGCTGGAGGCTGG - Intergenic
1200078944 X:153566117-153566139 CTCTGGAGGCTGCTGGGGGAGGG - Intronic