ID: 935340838

View in Genome Browser
Species Human (GRCh38)
Location 2:102058459-102058481
Sequence GGATGCACACACTGCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935340838_935340844 16 Left 935340838 2:102058459-102058481 CCAAGGTGGCAGTGTGTGCATCC No data
Right 935340844 2:102058498-102058520 TCTAGCTGTAATTTCAAGATTGG No data
935340838_935340845 17 Left 935340838 2:102058459-102058481 CCAAGGTGGCAGTGTGTGCATCC No data
Right 935340845 2:102058499-102058521 CTAGCTGTAATTTCAAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935340838 Original CRISPR GGATGCACACACTGCCACCT TGG (reversed) Intergenic
No off target data available for this crispr