ID: 935344960

View in Genome Browser
Species Human (GRCh38)
Location 2:102099351-102099373
Sequence TTTGAGTTCTTCCAGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935344950_935344960 11 Left 935344950 2:102099317-102099339 CCATTGGATGTTCGTACCCATCC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG 0: 1
1: 0
2: 1
3: 18
4: 326
935344954_935344960 -10 Left 935344954 2:102099338-102099360 CCAGTGGCCTTTGTTTGAGTTCT 0: 1
1: 0
2: 2
3: 23
4: 220
Right 935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG 0: 1
1: 0
2: 1
3: 18
4: 326
935344953_935344960 -6 Left 935344953 2:102099334-102099356 CCATCCAGTGGCCTTTGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 199
Right 935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG 0: 1
1: 0
2: 1
3: 18
4: 326
935344952_935344960 -5 Left 935344952 2:102099333-102099355 CCCATCCAGTGGCCTTTGTTTGA 0: 1
1: 0
2: 0
3: 13
4: 116
Right 935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG 0: 1
1: 0
2: 1
3: 18
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935344960 Original CRISPR TTTGAGTTCTTCCAGGGATG GGG Intronic
901236274 1:7669333-7669355 AGTGAGTGTTTCCAGGGATGAGG - Intronic
901324360 1:8358065-8358087 TCTAAGATCTGCCAGGGATGAGG + Intronic
901734296 1:11302518-11302540 TTTGATTTTTTGTAGGGATGGGG + Intergenic
903040202 1:20523885-20523907 TTTGAGTTCTGCCAACCATGGGG + Intergenic
904539604 1:31224048-31224070 CTTGAATGCCTCCAGGGATGAGG + Intronic
905232837 1:36525750-36525772 TTTGTGCACTTCCAGTGATGGGG + Intergenic
905689191 1:39930336-39930358 TTTGAATTTTTGCAGAGATGGGG + Intergenic
906469595 1:46117258-46117280 TTTGATTTTTTGTAGGGATGAGG - Intronic
907183465 1:52590640-52590662 TGTGAGTTCTTTGAGGAATGAGG - Intergenic
907254081 1:53165041-53165063 TTTGATTTTTTGTAGGGATGGGG - Intergenic
907275008 1:53312078-53312100 TTTCTATTCTTCCAGGCATGTGG - Intronic
908735778 1:67275187-67275209 TATGAATTCCTCAAGGGATGGGG + Intergenic
910779461 1:90913145-90913167 TTTTAATTCTTTCAGAGATGGGG + Intergenic
912602906 1:110956317-110956339 ACTGAGTTCATCCAGGGTTGGGG + Intronic
912713691 1:111967202-111967224 CCTGAGTATTTCCAGGGATGGGG - Intronic
912971386 1:114286891-114286913 TTTGAATTCTTTCCTGGATGGGG - Intergenic
913325379 1:117623638-117623660 TTTGATTTCTTCCTGGTCTGTGG - Exonic
914446833 1:147757737-147757759 TTTGAGCTCTTCCTTGGAGGAGG + Exonic
914839619 1:151237486-151237508 TTTGAGTTTTTGTAGTGATGAGG - Intronic
915310053 1:155002157-155002179 CTTGCGTTCGTCCAGGGAGGGGG - Intergenic
915594746 1:156890029-156890051 TCTGAGTTCTTCAAGGACTGAGG - Intergenic
916358420 1:163939222-163939244 TTTTAATTTTTTCAGGGATGTGG - Intergenic
916399259 1:164428527-164428549 CTTTAATTCTTCCAGGGCTGGGG + Intergenic
917672232 1:177283645-177283667 TTTGATACCTTCCAGTGATGGGG + Intergenic
918228117 1:182505178-182505200 TTGGAGTGTTTCCAAGGATGGGG - Intronic
919963718 1:202499425-202499447 TTGGAGTTTTTCTAGAGATGGGG + Intronic
920338797 1:205262498-205262520 TTGGGTTTCCTCCAGGGATGGGG + Intronic
921098830 1:211911013-211911035 TTTTGGTTCTTCCTGGGATCCGG - Intergenic
921407818 1:214800012-214800034 TTTGAGAACTTCCTGGGATGGGG - Intergenic
922135969 1:222826559-222826581 TTTAACTTCTTACAGAGATGGGG + Intergenic
1063227400 10:4028332-4028354 TGTAATTTCTTCCAGTGATGAGG - Intergenic
1063915811 10:10880856-10880878 TTTTATTTTTTCCAGTGATGAGG + Intergenic
1065359316 10:24874469-24874491 TTTCAGTACTTCCAGGGACTGGG + Intronic
1066481931 10:35804891-35804913 TTTGAGGTTTACCATGGATGTGG - Intergenic
1067510471 10:46890921-46890943 TTTGAGTTCTTTCAGAGGGGAGG - Intergenic
1067651783 10:48160941-48160963 TTTGAGTTCTTTCAGAGGGGAGG + Intronic
1068524582 10:58113599-58113621 TTTAACTTCTTAAAGGGATGAGG - Intergenic
1069836053 10:71308775-71308797 CTTGAATACTTCCAGAGATGAGG + Intergenic
1069932498 10:71892076-71892098 TTTGGGTTGTTGCAGGGATGTGG + Intergenic
1070271854 10:74964192-74964214 TTTGGGCTTTTGCAGGGATGGGG - Intronic
1072054658 10:91742490-91742512 TTTCAGTTCTTCCAGCTTTGTGG - Intergenic
1072080769 10:92028661-92028683 ATTGAGTACTTCAAGTGATGGGG - Intronic
1072131366 10:92497372-92497394 TTTAACTTCTTCCAAGGATGGGG - Intronic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1073747586 10:106487143-106487165 TTTTAGATCTTACAGGGTTGTGG + Intergenic
1075928967 10:126278007-126278029 GATGAGTTCTGTCAGGGATGTGG - Intronic
1077980043 11:7291000-7291022 TTTGGGTTCTTTCAGGCCTGTGG - Intronic
1079768682 11:24429894-24429916 ATTGAGTTCTTTGAGGGAGGAGG - Intergenic
1079876720 11:25866991-25867013 TTCAAATTCATCCAGGGATGAGG - Intergenic
1079992940 11:27265930-27265952 TCCAAGTTCTTCCAGGGATTTGG - Intergenic
1080462516 11:32467979-32468001 TTTTATTTTTTCTAGGGATGGGG - Intergenic
1080779508 11:35418357-35418379 TTTGGGTGCTTCCCGGGAGGCGG - Intronic
1081206336 11:40280176-40280198 TTTCAGTCCAGCCAGGGATGAGG - Intronic
1081401924 11:42653566-42653588 TGTGAGATCTCTCAGGGATGAGG - Intergenic
1082985247 11:59163362-59163384 TTTGATATCTTCAAGGGCTGTGG - Intergenic
1083193055 11:61066399-61066421 TTCGAGTTCTTTCAGGGCTTTGG - Intergenic
1083675444 11:64322528-64322550 CCTGAGCTCTTCCTGGGATGAGG - Intergenic
1084384279 11:68832913-68832935 CTCCAGTTTTTCCAGGGATGAGG - Intronic
1084459689 11:69289668-69289690 CTTGGGTTCCTCCTGGGATGGGG - Intergenic
1084939629 11:72605617-72605639 TCTGAGCTGTACCAGGGATGGGG + Intronic
1085696435 11:78708717-78708739 TTTCAGATCTTCCAGGGCTCTGG + Intronic
1085802151 11:79600621-79600643 TGTGAGCTCTTCCAGGGTAGGGG + Intergenic
1086184653 11:83998993-83999015 CATGAGTGCTGCCAGGGATGAGG + Intronic
1087828382 11:102792297-102792319 TTTGAGTACTCCCAGGAATATGG + Intronic
1087857888 11:103114490-103114512 TTTTAGTTCTTGTAGAGATGGGG + Intronic
1088601796 11:111486262-111486284 TTTGAGTTTTTGTAGAGATGGGG - Intronic
1091290453 11:134436593-134436615 CTTGAGTTCATCCAGGCTTGTGG - Intergenic
1091647066 12:2281881-2281903 TTAGAGTTCTCACAGGAATGGGG - Intronic
1091970423 12:4781944-4781966 CCTGAGCTGTTCCAGGGATGTGG + Intronic
1095057708 12:37635055-37635077 TTTGAGGCCTTCCATGGATAAGG - Intergenic
1095504840 12:42884397-42884419 TTTTATTTTTTGCAGGGATGGGG + Intergenic
1096175839 12:49518069-49518091 TTTCAGATCTTCCAAGGATGGGG + Intronic
1096951830 12:55480501-55480523 TTTTAATTCTTCCAGAGAAGAGG + Intergenic
1099690347 12:85944012-85944034 TTTGATTTTGTCCAGGGCTGAGG - Intergenic
1099819609 12:87693437-87693459 TTTGAGGACTTCCAGGGTTAGGG + Intergenic
1100769030 12:97900893-97900915 TTTCATTTCTTACAGAGATGGGG + Intergenic
1101595420 12:106160338-106160360 TTTTAGTTTTTGCAGAGATGGGG + Intergenic
1101868753 12:108544735-108544757 TTTTAGTTCTTGTAGAGATGGGG + Intronic
1101884131 12:108647236-108647258 ATTGAGTTCTTACTGGAATGTGG + Exonic
1101987354 12:109458013-109458035 TTTTTGTTCTTCCTTGGATGAGG + Exonic
1104171933 12:126290848-126290870 GTGGAGTTCTTCAAGGGAAGAGG - Intergenic
1104420599 12:128631472-128631494 TCTGAGATCCTCCAGTGATGGGG + Intronic
1105359233 13:19691744-19691766 TTTGTGTTTTTGTAGGGATGAGG - Intronic
1106703012 13:32249798-32249820 TCTCAGCACTTCCAGGGATGGGG + Intronic
1107076745 13:36329460-36329482 GTCTAGTTCTTCCAGGGATTTGG + Exonic
1107183738 13:37493081-37493103 TTTGAGTTCTCCCAGTGTTTGGG - Intergenic
1107614360 13:42149099-42149121 TTTGAGTTTTTGTAGAGATGGGG + Intronic
1109265265 13:60191614-60191636 ATTAGGTTCTGCCAGGGATGTGG - Intergenic
1110743127 13:79020413-79020435 TTTGAGTGGATCCAGGGATCTGG + Intergenic
1111451105 13:88417969-88417991 TTTGAGTGTTGCCAGGTATGAGG + Intergenic
1111910500 13:94305974-94305996 TTCCAGGTCTTTCAGGGATGTGG + Exonic
1112606840 13:100914740-100914762 TTTGAGTTGTTCCAGTTCTGGGG + Intergenic
1114653610 14:24302604-24302626 TTTGACTTCTCTCAGGTATGAGG + Intronic
1114890024 14:26908492-26908514 ATTGAGTTCTTCCATGTATATGG - Intergenic
1118802575 14:69204396-69204418 TTTGATTTCTTGTAGAGATGCGG - Intronic
1119036544 14:71234418-71234440 TTTGGATTGTACCAGGGATGGGG + Intergenic
1119425532 14:74532404-74532426 TGTGAGTGCTGGCAGGGATGGGG - Exonic
1120260710 14:82181396-82181418 TTTGAGTTCTTCAAGGATTTTGG - Intergenic
1120898341 14:89554308-89554330 TTTGATTTTTTCTAGAGATGAGG + Intronic
1126415130 15:48410041-48410063 TTTGTGTTCTTGCATGGATTTGG - Exonic
1126887880 15:53171648-53171670 TATGAATTTTTGCAGGGATGAGG - Intergenic
1127183202 15:56448059-56448081 TTTGAGTTGTTTCAGGTATGTGG + Intronic
1128409148 15:67376225-67376247 TTTAAGGACTCCCAGGGATGTGG - Intronic
1128646562 15:69382984-69383006 CTTGCATGCTTCCAGGGATGGGG - Intronic
1128969863 15:72099120-72099142 TTTGAGTTTTTGTAGAGATGAGG - Intronic
1129453304 15:75662744-75662766 TTGGGGTTCTACCTGGGATGGGG + Intergenic
1130864370 15:87919631-87919653 TTTGTATTTTTCCAAGGATGAGG - Intronic
1131545725 15:93314266-93314288 TTTAACTTCATCCAGGGACGAGG + Intergenic
1132010461 15:98271110-98271132 TTTGTGCTTTTCTAGGGATGAGG - Intergenic
1134092717 16:11400002-11400024 TCTGAGCTCTTCCAGAGATGGGG - Intronic
1134163517 16:11912168-11912190 TGTGTGTTTTTGCAGGGATGGGG - Intronic
1134272387 16:12744441-12744463 TTTTAATTCTTCCAGGCAGGAGG - Intronic
1135529795 16:23243315-23243337 TTTGTGTTTTTTCAGAGATGAGG + Intergenic
1136383791 16:29910529-29910551 TTTGACTTCTTACAGAGATCAGG + Intronic
1137627892 16:49921126-49921148 TTTGAGATATCCCAGGGCTGGGG + Intergenic
1138057477 16:53850339-53850361 TTTTTTTTTTTCCAGGGATGAGG + Intronic
1138173358 16:54873811-54873833 TTTGAGTTTTTCCAGTGGTAGGG - Intergenic
1138330699 16:56213124-56213146 TAGGAATTCTTCCAGGGAAGAGG + Intronic
1140483088 16:75273126-75273148 CCTGAGTCCTTCCAGGGCTGCGG - Intergenic
1141085457 16:81091981-81092003 TTTGACTTCTTCCACTGAAGGGG - Intronic
1141601785 16:85131130-85131152 TTTGAGTTGTGCCAAGGATACGG - Intergenic
1141610713 16:85179731-85179753 TTTTTGTTCTCCCTGGGATGAGG + Intronic
1143216323 17:5227823-5227845 GCTGAGTTCTTCTTGGGATGCGG - Intronic
1144303999 17:13950748-13950770 TTTGAGTATTTCCAATGATGGGG + Intergenic
1144414511 17:15033637-15033659 TGTGAACTCTACCAGGGATGGGG + Intergenic
1145179036 17:20728717-20728739 TTTGAATTTTTCTAGAGATGAGG + Intergenic
1146737590 17:35252113-35252135 TTTTAGTTTTCCCACGGATGTGG - Intronic
1146852687 17:36237008-36237030 TTTGAATTTTTCTAGAGATGAGG - Intronic
1146868597 17:36360902-36360924 TTTGAATTTTTCTAGAGATGAGG - Intronic
1146988837 17:37248494-37248516 TTTGATTTAATGCAGGGATGGGG - Intronic
1147071471 17:37961525-37961547 TTTGAATTTTTCTAGAGATGAGG - Intergenic
1147082998 17:38041052-38041074 TTTGAATTTTTCTAGAGATGAGG - Intronic
1147098941 17:38165023-38165045 TTTGAATTTTTCTAGAGATGAGG - Intergenic
1147962213 17:44174695-44174717 CTTGGGTTCTTACAGGCATGTGG + Intronic
1148548290 17:48533178-48533200 TTTGAGCTCTTTCAGAGTTGGGG - Intergenic
1149834763 17:59902747-59902769 TTTGATTTGTTGCAGAGATGGGG + Intronic
1150080477 17:62234060-62234082 TTTGAATTTTTCTAGAGATGAGG - Intergenic
1150955473 17:69854608-69854630 TTTGAGTTTTTCCAGGACAGAGG - Intergenic
1151282109 17:73084263-73084285 TTTGAGTTTTTGCAGAGATGGGG - Intronic
1151950937 17:77353477-77353499 CTTGAATGCTTCCAGGCATGGGG - Intronic
1152204134 17:78965067-78965089 TTTGAGTTTTTCTAGAGATGGGG - Intergenic
1152833664 17:82515387-82515409 TTTGAATTTTTTCAGAGATGGGG - Intergenic
1153039712 18:800838-800860 TTTTATTTTTTCCAGAGATGGGG - Intronic
1153409471 18:4777882-4777904 ATAGAGGTTTTCCAGGGATGTGG + Intergenic
1155975986 18:32132418-32132440 TTTGATTACTTGCAGAGATGGGG - Intronic
1157088679 18:44608983-44609005 CTTGAGTGCATCCAGGTATGAGG - Intergenic
1157230266 18:45909184-45909206 TTGGGGTTCTTACAGGGAAGAGG + Intronic
1157570802 18:48710797-48710819 TTTGATTTTTTGCAGAGATGGGG - Intronic
1157655413 18:49382824-49382846 CTTGAATTCTTGTAGGGATGGGG - Intronic
1158150377 18:54361162-54361184 ATTCAGTTCTTGGAGGGATGTGG + Intronic
1158392657 18:57056234-57056256 TTTCAGTTCTTCCAGGTCTCAGG - Intergenic
1158882984 18:61798890-61798912 TTTAAGTCCTTCCTGGGCTGAGG - Intergenic
1160559927 18:79749700-79749722 GTTGAGCTCTTCCAGGGGTTCGG + Intronic
1162087296 19:8256475-8256497 CTTGATTACCTCCAGGGATGGGG + Intronic
1162586637 19:11563508-11563530 TTTACTTTCTTCCTGGGATGGGG - Intronic
1162594573 19:11617721-11617743 TGTGAGTTCTTTCATGGATTCGG - Exonic
1162922230 19:13909929-13909951 TTTGAGCTTCTCCAGGGCTGGGG - Exonic
1163592476 19:18202282-18202304 TTCAAGTTCTTCCATGTATGAGG - Intronic
1164713554 19:30375788-30375810 TTTGAGTGCTTACAGGAATGTGG + Intronic
1164815001 19:31191682-31191704 TTTAACTTTTTCTAGGGATGGGG - Intergenic
1165409673 19:35651576-35651598 TTTGTTTTTTTCCAGAGATGGGG + Intronic
1165839680 19:38780671-38780693 TTTTATTTCTTCTAGAGATGAGG - Intergenic
1167137322 19:47624864-47624886 TTTAAGTTTTTGCAGAGATGAGG + Intronic
925303363 2:2832674-2832696 CGTGGGTTCTTCCAGGGGTGGGG - Intergenic
925914100 2:8592443-8592465 TTTGAATGCTCCCAGGGATGAGG - Intergenic
927049597 2:19313840-19313862 ATTGAGGTCTTCCAGAGAAGGGG + Intergenic
927935538 2:27073925-27073947 TTTCAGTTCTTCCAGGCACTGGG - Intergenic
930262562 2:49164658-49164680 TTTGAGTTTTCCAAGGGAAGGGG - Intergenic
933292513 2:80453324-80453346 ATTGTGTTCTTCCAGGGTTAGGG - Intronic
935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG + Intronic
935367762 2:102312894-102312916 TTTAATTTCTTCCAGGCATAAGG + Intronic
935955488 2:108372646-108372668 TTTGTGTTCTAGCAGAGATGGGG + Intergenic
936006808 2:108896470-108896492 TTTGACGTCTTCCAGTGAAGTGG + Exonic
938224511 2:129604432-129604454 TTTGTGGTCCTGCAGGGATGGGG - Intergenic
938959933 2:136331735-136331757 AGGGAGTTCTTTCAGGGATGGGG - Intergenic
939894292 2:147773131-147773153 TTTGAGTTCTTCAAGAGGTATGG - Intergenic
940316163 2:152329818-152329840 TTTTATTTTTTCCAGAGATGGGG - Intergenic
941117064 2:161484124-161484146 TTTGAGTTTTTGTAGAGATGGGG + Intronic
942086910 2:172452307-172452329 CTTGATTTCTTCCAGGGAACAGG + Intronic
942821958 2:180125090-180125112 TTTGAGGGCTTTCAGGAATGAGG - Intergenic
946071591 2:217038737-217038759 TTTTGGCTCTTCCAGAGATGAGG - Intergenic
946529445 2:220556003-220556025 TATGATTTCTTGTAGGGATGGGG - Intergenic
946620350 2:221555225-221555247 TTTGAATGCTTCCAGAGATCAGG - Intronic
947722676 2:232379185-232379207 TTTCTGTTCCTTCAGGGATGGGG + Exonic
948319303 2:237056719-237056741 ATTGACATCTCCCAGGGATGGGG - Intergenic
1171468054 20:25346297-25346319 TTAGTGGTCATCCAGGGATGGGG + Intronic
1171807696 20:29698404-29698426 TTTGAGTCCTTCGAGGGAAATGG - Intergenic
1171856092 20:30344804-30344826 TTTTAGTTTTTACAGAGATGAGG + Intergenic
1173110955 20:40189757-40189779 TTTGTGTAGTTCCAGGGATATGG - Intergenic
1174521168 20:51131872-51131894 CTGGAATACTTCCAGGGATGGGG - Intergenic
1177167783 21:17622282-17622304 TTTGAGCTCCTCCTGGGCTGGGG - Intergenic
1179919925 21:44502607-44502629 TTTGGATTCTGTCAGGGATGCGG - Intronic
1180938970 22:19644524-19644546 TGAGAGATCTGCCAGGGATGAGG - Intergenic
1183309961 22:37104062-37104084 TTTCAGGTCACCCAGGGATGTGG + Intronic
1183593646 22:38796516-38796538 CTTGAGTGCTCCCTGGGATGAGG + Intergenic
949289360 3:2445865-2445887 TTTGAGGTTTTGCAGAGATGGGG + Intronic
950251347 3:11468340-11468362 CATCAGTTCTTCCAGGGAAGTGG - Intronic
950999182 3:17538295-17538317 TTTGAGATCTTCCTGAGAAGTGG - Intronic
951565313 3:24007153-24007175 TTTGAATTCTTGTAGAGATGAGG - Intergenic
952220253 3:31317199-31317221 TGGGAGTTCTGCCAGGGCTGTGG + Intergenic
954089728 3:48274510-48274532 TTGGAGTTTTTCCGGGGAGGGGG - Intronic
954269860 3:49499456-49499478 TGTGAGTTTTTCTATGGATGAGG + Intronic
955367427 3:58323078-58323100 TTTGATTTTTTGCAGAGATGAGG + Intergenic
955723182 3:61905021-61905043 TTTGAGGTCTTCTAGGGACTGGG - Intronic
955737469 3:62054657-62054679 TTTGAATTCTTCCAGGTATTTGG + Intronic
956399467 3:68861707-68861729 TTTGAAGTCTTCCAAGGCTGTGG - Intronic
956864648 3:73357055-73357077 ACTGAGATCTTCCAGGGAAGAGG - Intergenic
958228760 3:90867548-90867570 TTTGAGTGCTTTCAGGCCTGTGG + Intergenic
958243682 3:91118156-91118178 TTTGAGTGCTTTCAGGCCTGTGG + Intergenic
960201803 3:114845938-114845960 CTTGAGGACTTCCAGGTATGTGG + Intronic
964436563 3:156659384-156659406 GTTGAGTTCATCCAGGATTGAGG - Intergenic
965093296 3:164189720-164189742 TTTGAGTGCTTACAGTGAAGAGG + Intergenic
967107412 3:186265192-186265214 TCTAAGTTGTTCCAGGGCTGTGG - Intronic
967683582 3:192394214-192394236 ATTAAGTTCTTCCGGGGCTGAGG + Intronic
969206614 4:5652024-5652046 TTTGAGTTTTACCAGGGAACAGG + Intronic
969438112 4:7200108-7200130 TTTGAGCACTTCCAGCGAGGGGG - Intronic
969820390 4:9715791-9715813 TTTTAGTTTTTCTAGAGATGAGG + Intergenic
969900173 4:10341973-10341995 TTGGAATTCTTCCTTGGATGAGG + Intergenic
970841491 4:20476923-20476945 TTTGATTTATTCTAGGTATGGGG - Intronic
970881740 4:20940339-20940361 TTTGAGTTCTTCGAGGAAGATGG + Intronic
971776352 4:30971069-30971091 TTTGAATATTTCCAGTGATGTGG - Intronic
972145234 4:36015940-36015962 TTAGAGTTCTTCCATGGAAGCGG - Intronic
973559935 4:52125080-52125102 TTTAAGTTATTCCAGGAAAGAGG + Intergenic
976705754 4:88017149-88017171 TTTGATTTTTTGCAGAGATGAGG - Intronic
976845684 4:89486926-89486948 TTTGAATTCTTCAATGTATGTGG - Intergenic
976897812 4:90132742-90132764 TTTAAGTTATTCCAGGTATAGGG - Intronic
976928496 4:90532988-90533010 TTTGAGATTTTACAGGGTTGAGG + Intronic
977273345 4:94945605-94945627 TTTGACTTTTTGCAGAGATGAGG + Intronic
982883146 4:160744909-160744931 TATGAGTTCTAACAGGCATGAGG - Intergenic
982936911 4:161490819-161490841 TTTGATTTCTTACAGTTATGTGG + Intronic
983513822 4:168636313-168636335 TTTTATTTTTTGCAGGGATGGGG - Intronic
984056782 4:174940141-174940163 TTAGTTTTCTTCCAGGGCTGTGG + Intronic
984636395 4:182115007-182115029 TTTGTATTATTCCAGAGATGAGG - Intergenic
986477692 5:8152647-8152669 TTTGACAACTTCCAGTGATGAGG - Intergenic
988973333 5:36491208-36491230 TCTGTTTTCTTCCAGGGAGGCGG + Intergenic
989920917 5:49802012-49802034 TTTGAGTGCTTTGAGGGCTGTGG + Intergenic
989929846 5:49934186-49934208 TTGGAGTGCTTTCAGGGCTGTGG + Intergenic
989933722 5:49991759-49991781 TTGGAGTGCTTTCAGGGCTGTGG + Intergenic
989933870 5:49993973-49993995 TTTGAGTGCTTTGAGGGCTGTGG + Intergenic
991049273 5:62255120-62255142 TTTGAGTCCTTCCAGGACTATGG + Intergenic
993755118 5:91719737-91719759 TTTGATTTATTCCAAGGATTTGG + Intergenic
994243451 5:97450806-97450828 TTTGTATTCTTGCAGAGATGGGG - Intergenic
996124380 5:119707804-119707826 GTGAAGTTCTTCCAGGGATCAGG + Intergenic
996255154 5:121391865-121391887 TTAGAGTTCTACCAGGTTTGAGG - Intergenic
997612756 5:135226653-135226675 CTTGAATACCTCCAGGGATGGGG - Intronic
998825095 5:146093416-146093438 TCTGAGCACTTCCAGGGAGGAGG - Intronic
999970496 5:156856673-156856695 TTTGTATTTTTCCAGAGATGGGG - Intergenic
1000168497 5:158678543-158678565 TTTGTTTGCTACCAGGGATGTGG + Intergenic
1000322028 5:160142089-160142111 CTTGAGATTTCCCAGGGATGTGG + Intergenic
1001304195 5:170559824-170559846 TTTGAGTTCTTGCTTGGTTGTGG - Intronic
1001619056 5:173066983-173067005 TTTGATTTTTTGCAGAGATGGGG + Intronic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1202776852 5_GL000208v1_random:87423-87445 TTGGAGTTCTTTGAGGGCTGTGG - Intergenic
1004071866 6:12306163-12306185 CTTGAGTCCTTACAGGGATCCGG + Intergenic
1004312733 6:14559868-14559890 TTTGAATACTCCCAGTGATGTGG - Intergenic
1006232662 6:32597561-32597583 TTTGAGTTTTTCCAGAAGTGAGG + Intergenic
1007672003 6:43563305-43563327 TTTGATTTTTTGTAGGGATGAGG + Intronic
1010238490 6:73595324-73595346 TTTGGGTTGTTTCAAGGATGAGG - Intronic
1011867593 6:91850223-91850245 TTTGAGTATTTCTAGGGATTGGG - Intergenic
1012669461 6:102023767-102023789 GTTGAGTTACTCCAGGGCTGGGG + Intronic
1013226023 6:108119785-108119807 ACTGAGTCCTTCCTGGGATGGGG + Intronic
1013609285 6:111779071-111779093 TTCAAATTCTTCCAGAGATGAGG - Intronic
1013703034 6:112796777-112796799 TTTCATTTTCTCCAGGGATGTGG + Intergenic
1015721821 6:136250316-136250338 TTTGATTTCGTCCTGGGATGCGG - Intronic
1015749178 6:136543186-136543208 TTTGAGTTGTTCCCGGGTTTTGG - Intronic
1017794138 6:157825862-157825884 TTTGTCTTCTTCAAGGGGTGGGG + Intronic
1018006931 6:159631100-159631122 ATTGTGTTTTTCCTGGGATGTGG - Intergenic
1018051748 6:160015433-160015455 CTTGAGTTCTTGCTGTGATGCGG + Intronic
1018435561 6:163755349-163755371 GTTGAGTTCGTCCAGAGTTGGGG - Intergenic
1018775632 6:167012765-167012787 TGTGAGTTTTTCCAGAGAAGGGG + Intronic
1018960895 6:168447979-168448001 TTTGATTTCTTCTTGGGATTAGG + Intronic
1019616622 7:1965860-1965882 TTTGTGGTCCTCCAGGGACGTGG - Intronic
1019814691 7:3190871-3190893 TTTAATTTCTTACTGGGATGAGG - Intergenic
1019906436 7:4068595-4068617 TCTGAGCTGTACCAGGGATGGGG + Intronic
1022990632 7:35703705-35703727 TTTTAGTTCTTGCAGGCATAGGG + Intergenic
1024282819 7:47733475-47733497 TCTGAGTTCTTCCTGCAATGCGG + Intronic
1024584245 7:50827395-50827417 GATGAGTTCTTCCAGGGATGGGG - Intergenic
1027243137 7:76346389-76346411 TGTCAGTTCTACCAGGGAAGAGG + Intronic
1028459874 7:91079672-91079694 TTTGAGTTCCTAGAGCGATGTGG + Intronic
1028928303 7:96384547-96384569 TTTGAGATCTTGCTGGGCTGAGG - Intergenic
1029146531 7:98450194-98450216 TTGTAATTTTTCCAGGGATGGGG - Intergenic
1032724638 7:134579376-134579398 CTTGTGTTCTTGCAGGGAGGAGG + Intronic
1033096718 7:138438696-138438718 TTGGAGTTTCTTCAGGGATGGGG + Intergenic
1033279818 7:139997954-139997976 TTTGAGTTGTTCCCAGGTTGGGG - Intronic
1034310473 7:150083392-150083414 TTTGAGTTTTTGTAGAGATGGGG - Intergenic
1034553129 7:151833657-151833679 TTTCAGTTGTTCCAGGGGTGGGG + Intronic
1034796367 7:154017238-154017260 TTTGAGTTTTTGTAGAGATGGGG + Intronic
1036384927 8:8270533-8270555 TTTGCATTCTTCCAGGGACTTGG + Intergenic
1036742684 8:11379222-11379244 TTTGAGTTCTTCCCAGTTTGGGG + Intergenic
1036765489 8:11547167-11547189 TCTGAGCTTTTCCAGGGAAGGGG - Intronic
1037703817 8:21298252-21298274 CTTGAGTCCTTCCAGGTGTGGGG - Intergenic
1037924093 8:22831128-22831150 GTTAAGTAGTTCCAGGGATGGGG - Intronic
1038349595 8:26763821-26763843 TTTGACTTTTTGCAGGGAGGGGG - Intronic
1039520610 8:38167874-38167896 TTTTTTTTCTTCCAGAGATGGGG - Intronic
1041915280 8:63132786-63132808 TTTGAATTTTTGCAGAGATGGGG + Intergenic
1042526725 8:69772056-69772078 TCTGAATTCTGCCAGGAATGAGG - Intronic
1042916663 8:73882090-73882112 TTTTTTTTCTTCCAGGGAAGTGG - Intergenic
1043942542 8:86212060-86212082 TTTGTATACTCCCAGGGATGGGG - Intergenic
1045495108 8:102701497-102701519 TTTGAATTCCTCCAGAGACGGGG - Intergenic
1045813589 8:106253628-106253650 CTTGAGTTGTTCCAGTAATGAGG + Intergenic
1045974804 8:108120343-108120365 TTTGAGTTGCCCCAGGGATGGGG - Intergenic
1047325722 8:123834236-123834258 TTTGAGTTGTTTCCGGTATGGGG - Intergenic
1047373873 8:124277959-124277981 TTTGAGGTCTAACAGGAATGGGG + Intergenic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1050196309 9:3087790-3087812 TTTGATTTCTTCTAGGCAAGAGG - Intergenic
1051215948 9:14797635-14797657 TTTTCCTTCTTCCAGGAATGAGG - Exonic
1051387260 9:16522542-16522564 TTAGATTTTTTACAGGGATGGGG + Intronic
1051473522 9:17476685-17476707 CTTCAGTTCTTCAAAGGATGAGG + Intronic
1052629672 9:31021123-31021145 TTTGAGTTTTTCCATGGAGGTGG + Intergenic
1055052084 9:71991112-71991134 AGTAAGTTCTTCCAGGGAAGAGG - Intergenic
1055564845 9:77557976-77557998 CTGGGGTTCTTCCAGGGTTGTGG - Intronic
1055657364 9:78464695-78464717 CTTGAGTCCTTCCTGGAATGAGG + Intergenic
1056016647 9:82395723-82395745 TTTGGGTTTTTCCAGTGATAGGG - Intergenic
1056163871 9:83923394-83923416 TTTGATTTTTTGTAGGGATGGGG - Intergenic
1057399897 9:94714106-94714128 TTTAAATTTTTCCAGGGATGTGG + Intergenic
1057926181 9:99152270-99152292 TTTGACTTCAGCCATGGATGAGG + Exonic
1058092517 9:100821429-100821451 GTTGAGTTAATCCAGGGTTGGGG - Intergenic
1058984515 9:110198576-110198598 TTTGAGTTCTGCCACGGTCGTGG + Intronic
1059959854 9:119554473-119554495 TTTGAATGCTTCTGGGGATGGGG - Intergenic
1060364111 9:122991776-122991798 TTTAAGTTTTTCTAGAGATGGGG + Intronic
1060522611 9:124302174-124302196 CTTGAATGCTTCCAGTGATGGGG + Intronic
1060717183 9:125943445-125943467 TATGACTTCTTCCAGGTATAGGG - Intronic
1061133758 9:128722075-128722097 TTTGAGCTCCTCCTGGAATGAGG + Exonic
1062102354 9:134734872-134734894 CTTGAGTTCTGCCAGGTCTGAGG + Intronic
1062208176 9:135348645-135348667 ATTGAGTCCTGCCAGGGAGGGGG - Intergenic
1186175899 X:6925567-6925589 TTTGTGTTTTTCCTGGGCTGTGG - Intergenic
1186790518 X:12993186-12993208 TTGCAGCTCTTCCAGGGCTGAGG + Intergenic
1186906265 X:14114356-14114378 TTTAATTTATTCCAGGGCTGGGG - Intergenic
1187100914 X:16190698-16190720 TTTGATTTTTTGTAGGGATGGGG - Intergenic
1187956768 X:24526260-24526282 TTTGAGTTGTTCAAGGTAAGTGG + Exonic
1188646748 X:32578041-32578063 TTTGAGTGATTCCAGAGCTGAGG - Intronic
1189175703 X:38955303-38955325 TTTGAGTCCTTCCTGGCATCTGG + Intergenic
1189296212 X:39920086-39920108 ATCGAGGTCTTCCAGGGAAGGGG + Intergenic
1189507437 X:41625974-41625996 TTTGTGTTTTTGCAGAGATGGGG + Intronic
1190104523 X:47549854-47549876 TTTGATTTCTTGTAGAGATGGGG + Intergenic
1191998759 X:67125769-67125791 CTTGAATTCTTCCAGTGAAGGGG - Intergenic
1192384455 X:70652064-70652086 TTTGCAGTTTTCCAGGGATGTGG - Intronic
1193842153 X:86419363-86419385 TGTGAGGTCTCCCAGGCATGTGG - Intronic
1194764773 X:97837136-97837158 TGGGGGGTCTTCCAGGGATGTGG - Intergenic
1197652068 X:129076003-129076025 TTTGAGTTCCTCTAAGGAAGTGG + Intergenic
1199247367 X:145621690-145621712 TTTGAGATGTTACAGGTATGAGG - Intergenic
1200047933 X:153412382-153412404 TTTGAGATCTGCCAGGGACACGG + Intergenic
1200738534 Y:6827944-6827966 TAGGAGTTCTTTCAGGCATGGGG + Intergenic
1200957953 Y:8970448-8970470 TGTGTGTTCGTCCAGGGAAGCGG - Intergenic
1202299362 Y:23395272-23395294 TTGGAGTTTTTCTAGAGATGGGG + Intergenic
1202571447 Y:26275326-26275348 TTGGAGTTTTTCTAGAGATGGGG - Intergenic