ID: 935348364

View in Genome Browser
Species Human (GRCh38)
Location 2:102130490-102130512
Sequence ACTCTTGGTGGCACAAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935348359_935348364 2 Left 935348359 2:102130465-102130487 CCTTGACAGCTGTTCTTTCCTTT 0: 1
1: 0
2: 6
3: 47
4: 532
Right 935348364 2:102130490-102130512 ACTCTTGGTGGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 106
935348357_935348364 25 Left 935348357 2:102130442-102130464 CCTCACTCTTATCTTTCCTCTTT 0: 1
1: 1
2: 5
3: 117
4: 1044
Right 935348364 2:102130490-102130512 ACTCTTGGTGGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 106
935348356_935348364 26 Left 935348356 2:102130441-102130463 CCCTCACTCTTATCTTTCCTCTT 0: 1
1: 1
2: 5
3: 118
4: 1153
Right 935348364 2:102130490-102130512 ACTCTTGGTGGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 106
935348358_935348364 9 Left 935348358 2:102130458-102130480 CCTCTTTCCTTGACAGCTGTTCT 0: 1
1: 1
2: 2
3: 30
4: 312
Right 935348364 2:102130490-102130512 ACTCTTGGTGGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935348364 Original CRISPR ACTCTTGGTGGCACAAGCTT GGG Intronic