ID: 935349011

View in Genome Browser
Species Human (GRCh38)
Location 2:102137572-102137594
Sequence CTTGATGCCCAGAGCTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935349011_935349013 15 Left 935349011 2:102137572-102137594 CCTGGCAAGCTCTGGGCATCAAG 0: 1
1: 0
2: 0
3: 19
4: 160
Right 935349013 2:102137610-102137632 AGTCCCAGGAAGAACCTGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 256
935349011_935349012 1 Left 935349011 2:102137572-102137594 CCTGGCAAGCTCTGGGCATCAAG 0: 1
1: 0
2: 0
3: 19
4: 160
Right 935349012 2:102137596-102137618 CTGAGTGTTCTAAGAGTCCCAGG 0: 1
1: 0
2: 2
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935349011 Original CRISPR CTTGATGCCCAGAGCTTGCC AGG (reversed) Intronic
900103446 1:972395-972417 CCTGGTGCCGAGAGCTTCCCAGG + Exonic
901532217 1:9860751-9860773 CTTGCTGGCCAGAACTTCCCAGG + Intronic
901780804 1:11593378-11593400 CTGGAAGCCCAGAGCTGGCAAGG - Intergenic
902432534 1:16374452-16374474 CTTGATACCCAGAGCACGCTGGG - Intronic
904333922 1:29784924-29784946 GGTGATGCCCAGAGCCTGGCAGG - Intergenic
904494125 1:30877229-30877251 CTTGATGGCCATTGCTTACCTGG - Intronic
904903454 1:33875996-33876018 TTTGCTGCCGAGAGCTGGCCTGG - Intronic
909028248 1:70507848-70507870 CTTGATTCCCATAGCTTGATAGG - Intergenic
911209497 1:95124526-95124548 CATGTTGCCCAGTGCTAGCCAGG + Intronic
911411682 1:97517214-97517236 CTTGAAGCCCAGAACATCCCTGG - Intronic
911826440 1:102492125-102492147 CAAGATGCCTAGAGCTTACCAGG + Intergenic
915768449 1:158391939-158391961 CTTGAAGCCTAGAGCATGCCTGG + Intergenic
916416300 1:164595231-164595253 ATTGTTGCCCAGAGCTTCCCTGG + Intronic
917053361 1:170950209-170950231 CTTGATACCCAGAGCAGGCAAGG - Intronic
920051323 1:203166682-203166704 CTTCTTGCCCTGAGCTTTCCGGG + Exonic
920165574 1:204033223-204033245 CTGGATCCCCAGAGTTTGTCTGG - Intergenic
921451305 1:215309355-215309377 ATAGATGCCCAGAGCTTGTTGGG - Intergenic
923138415 1:231139515-231139537 CTTGGTGACCAGAGCTTGGCTGG + Intergenic
1062915989 10:1241629-1241651 CCTGATGGCCAGAGCAGGCCAGG + Intronic
1068921741 10:62492334-62492356 CTTGATGTCCATGGCTAGCCTGG - Intronic
1069566719 10:69468272-69468294 CTGGCTGCCCACAGCCTGCCTGG + Intronic
1070960007 10:80492027-80492049 CTGGGTGCCCAGAGCCAGCCCGG - Intronic
1072640182 10:97205703-97205725 CTATATGCACAGAGTTTGCCTGG + Intronic
1074923930 10:118047214-118047236 CTGGATGCCCAGTGCCTGGCAGG + Intergenic
1076684237 10:132189897-132189919 GTCGGTGCCCAGAGCTTGGCAGG - Intronic
1077919335 11:6631238-6631260 CTTGGGGCCCAGAGCTGGGCAGG + Intronic
1078106686 11:8362200-8362222 CTTGATGGACGGAGCTTGACTGG - Intergenic
1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG + Exonic
1079877362 11:25876786-25876808 CTTACAGCCCAAAGCTTGCCAGG + Intergenic
1080781257 11:35432004-35432026 CATGAAGCCCAGATCTTCCCTGG + Exonic
1084603457 11:70159834-70159856 CTTGTTCCCCGGAGCTGGCCAGG + Intronic
1085517400 11:77119454-77119476 GTAGATGCCCAGAGCCTCCCAGG - Intronic
1085996565 11:81923153-81923175 CTTGATAACCAAACCTTGCCAGG - Intergenic
1088582337 11:111328215-111328237 CCTGATGCCCACGGCCTGCCAGG + Intergenic
1089192248 11:116661577-116661599 CTCCATTCCCAGTGCTTGCCAGG - Intergenic
1089868535 11:121652368-121652390 CTTCATGCCCAGTGCTTCCGAGG + Intergenic
1090466866 11:126942780-126942802 CTTGAGCCCTGGAGCTTGCCGGG + Intronic
1091934269 12:4423030-4423052 CTTCATTCCCAGAGTTTGCAGGG + Intergenic
1096567820 12:52496073-52496095 CTTGGTTCCCAGAGCATGCCTGG - Intergenic
1101212804 12:102551489-102551511 CTGGCTGCCTAGAGCTTTCCAGG + Intergenic
1101244472 12:102872648-102872670 CTTGATGCCCACACCTTGAAAGG + Intronic
1101322362 12:103683958-103683980 CTAGATTCCCAGAGCTACCCTGG - Intronic
1101652947 12:106694299-106694321 CCTGATGCCTACAGCCTGCCTGG - Intronic
1102590797 12:113955436-113955458 CCAGGTGCCCATAGCTTGCCAGG - Intronic
1103704350 12:122863241-122863263 CTCAATGCCCACAGCTTCCCTGG + Intergenic
1103938123 12:124487160-124487182 CTAGATGCCCAGCTCTTGGCAGG + Intronic
1104365240 12:128170789-128170811 CCTGATGCCCAAAGCTCTCCCGG + Intergenic
1104856022 12:131902886-131902908 CTTGATTCTGGGAGCTTGCCCGG + Intronic
1104953105 12:132451251-132451273 CTGGATGCCCTGAGCTGGTCGGG - Intergenic
1108510742 13:51153325-51153347 CTTGATGCCCTGGGCATGCAGGG - Intergenic
1109301586 13:60595072-60595094 CTAGATGCCTGGAGCTTTCCTGG - Intergenic
1115377877 14:32698393-32698415 ATTGGTGCCCAGGCCTTGCCAGG + Intronic
1118357400 14:65026228-65026250 CTTGATAACCAGGGCTTTCCTGG + Intronic
1119641876 14:76321596-76321618 CTTGTTGTCTAGTGCTTGCCTGG + Intronic
1121330245 14:93045136-93045158 CTTGATGCCCTGTGCCTGCAAGG - Intronic
1121564847 14:94901603-94901625 CAAGATGCCCATGGCTTGCCAGG + Intergenic
1122280342 14:100618522-100618544 CTGGCTGCCCAGAGCTTTCTGGG + Intergenic
1124122979 15:26908000-26908022 CCTGATGCCCAAATCCTGCCTGG - Intronic
1126681172 15:51203435-51203457 TTTGATGCCCATTGGTTGCCAGG - Intergenic
1128721889 15:69956133-69956155 CTTGATGCCCACAGTGTGCAAGG - Intergenic
1129220331 15:74128563-74128585 CTATCTGCCCAGAGCTTCCCTGG - Exonic
1130043246 15:80423905-80423927 CTTGAAGCCAAACGCTTGCCTGG - Intronic
1136022572 16:27449293-27449315 CTGGATGTCCAGAGCTGGCCAGG + Exonic
1137702732 16:50508459-50508481 CATGATGTCCAGTGCTGGCCAGG + Intergenic
1138346290 16:56322306-56322328 CTTGCTGGTCAGAGCGTGCCTGG - Intronic
1141064089 16:80900043-80900065 CTTGTTGCCCAGAACTGGCTGGG - Intergenic
1145078447 17:19874569-19874591 CATGCTGCCCAGACCTTCCCTGG - Intergenic
1149378308 17:56067869-56067891 CTAGATGCCCAGGTCTTTCCAGG - Intergenic
1149654550 17:58303316-58303338 CTTGCTGCCCGGAGCCTGGCAGG + Intronic
1152167965 17:78723247-78723269 GTTGCTGCCCAGGGCTGGCCAGG - Intronic
1152192950 17:78899559-78899581 CTCTAGGCCCAGAGATTGCCAGG - Intronic
1152280736 17:79383702-79383724 GTTAATGCCCAGAGCTTGGTGGG + Intronic
1152998125 18:427475-427497 CTTGATGGGCAGAGCTGACCTGG + Intronic
1156066849 18:33152489-33152511 CTGGAAACCCAGAGCTCGCCAGG + Intronic
1160538646 18:79608796-79608818 TGTGATGCTCAGAGCTTGGCCGG - Intergenic
1161171343 19:2813855-2813877 CTTGATGGCCAGAGCTGAGCAGG - Exonic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1164752592 19:30667706-30667728 CTGGAAGCCCAGAGCATGTCAGG + Intronic
1167579502 19:50333254-50333276 CTTGCTGCCCAGAGCTGCCGGGG - Intronic
1167811366 19:51834292-51834314 CTTGAGGCCAGGAGTTTGCCTGG - Intergenic
925645846 2:6036267-6036289 ATTGATGCCCAATGGTTGCCAGG - Intergenic
927455818 2:23248394-23248416 CTTAATGCCCAGAGGTGGCCAGG - Intergenic
927920986 2:26971359-26971381 CTGGCTGCTCAGAGCTTGCAGGG + Intronic
929396320 2:41527199-41527221 CCAGATACCCAGACCTTGCCTGG + Intergenic
929792227 2:45031709-45031731 CTTGATGCCAGGAGCCAGCCTGG + Intergenic
932229131 2:70068080-70068102 ATTGGTGACCAGGGCTTGCCTGG - Intergenic
934655023 2:96112841-96112863 CTTGTTGCCCAAAGGCTGCCTGG - Intergenic
934662520 2:96150643-96150665 ACTGATGCCCAGAGCTTCCCCGG - Intergenic
934709681 2:96506802-96506824 CCTGAGGGCCATAGCTTGCCAGG - Intronic
934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG + Intergenic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
937114792 2:119397408-119397430 CTTGCTGGCCTGACCTTGCCTGG - Intergenic
937979300 2:127605108-127605130 CTATATGCACTGAGCTTGCCTGG + Intronic
938344440 2:130557149-130557171 CTGGGTGCCCACAGCCTGCCTGG - Intergenic
938345393 2:130563573-130563595 CTGGGTGCCCACAGCCTGCCTGG + Intergenic
942210035 2:173660844-173660866 CCTGCTGCCCAGGGCTTGCCAGG - Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
945832011 2:214798900-214798922 CTTGAGGCCAGGAGCTTGACTGG + Intronic
948302063 2:236914894-236914916 CTTGATGGCCAGAGATTGATGGG + Intergenic
1169405426 20:5317428-5317450 CTGTATGCCCAGAGCTTCCTGGG - Intergenic
1169775674 20:9250205-9250227 TAGGATGCCCAGAGCTTGCAAGG - Intronic
1170072410 20:12382782-12382804 CTTTATGTCCAGAGCCTGCTTGG + Intergenic
1172694122 20:36809956-36809978 CGTGGTGCCCAGCGCTTTCCAGG - Intronic
1172845146 20:37925716-37925738 TCTGATCCCCAGAGCTGGCCAGG - Intronic
1173223110 20:41145605-41145627 CTTGCTTCCCAGAGCTTTGCTGG + Intronic
1174050085 20:47761573-47761595 CTTGATGCAAATAGCTTCCCAGG + Intronic
1174201172 20:48807732-48807754 CATAATGCCCAGCGCTGGCCTGG - Intronic
1174230852 20:49044664-49044686 CTTGAGGCCAGGAGTTTGCCTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175948985 20:62572382-62572404 CTTGAGGCACAGAGCAAGCCTGG - Intergenic
1175965841 20:62659864-62659886 CTGGATGCCCAGAGCTTGGATGG + Intronic
1178702784 21:34847646-34847668 CTAGATGCTCAGAGCTTTGCAGG + Intronic
1181655438 22:24294041-24294063 CATGAAGCCCAGGGCTTGACTGG + Intronic
1181709317 22:24671664-24671686 CATGAAGCCCAGGGCTTGACTGG + Intergenic
1181844310 22:25694353-25694375 CTTGAAGGGCTGAGCTTGCCCGG - Intronic
1182472123 22:30555112-30555134 CTTGGTGCCCAGCGGCTGCCAGG + Exonic
1183589197 22:38770087-38770109 CTCGATGCCCAGGGCTGGCCGGG - Intronic
1184289848 22:43492774-43492796 CTCAAGGCCCAGAGCTTGGCTGG + Intronic
1184460556 22:44635355-44635377 CTGGAAGCCCAGAGCTTGTGGGG + Intergenic
1185139906 22:49094307-49094329 CTGGCAGCCCAGAGCGTGCCCGG - Intergenic
953753047 3:45624061-45624083 GCTGATGCCCAGAGCTGTCCAGG + Intronic
955689027 3:61572595-61572617 CTGGGTGCCTAGAGCATGCCAGG + Intronic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
961773604 3:129268148-129268170 CATGATGCCATGAGGTTGCCAGG - Intronic
962426104 3:135270693-135270715 CTTGATGACCAGACCCTGCCTGG + Intergenic
962953171 3:140240089-140240111 CTTTATGGCCAGAGCTAGGCTGG - Intronic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
969370685 4:6729223-6729245 CTTTATGCGCACTGCTTGCCTGG - Intergenic
969638818 4:8384771-8384793 CTTGCTTTCCAGGGCTTGCCTGG - Intronic
978878738 4:113674490-113674512 CTTGATGCCCACAGTTTACAAGG + Intronic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979943234 4:126790220-126790242 TTTTGTGCCCAGAGTTTGCCAGG + Intergenic
980113625 4:128658639-128658661 CTTTTTGTCCAGAGCTGGCCAGG - Intergenic
982081341 4:151793274-151793296 CTTGGTGCCTTGAGCTTCCCAGG + Intergenic
984845868 4:184107264-184107286 CTTGAAGCAAAGAGCTTGGCTGG + Intronic
987323524 5:16792387-16792409 CTCTGTGCCAAGAGCTTGCCAGG - Intronic
992172283 5:74115420-74115442 TTTGATGTCCAGAGTTTGCCAGG + Intergenic
992229491 5:74649988-74650010 GAGGATACCCAGAGCTTGCCTGG - Intronic
992908392 5:81370820-81370842 CTTCATGCCCAGAGATTGAAGGG + Intronic
992938702 5:81739565-81739587 CCTGATGGGCAGAGATTGCCAGG + Intronic
997973744 5:138426095-138426117 CATGACTCCCAGAGCATGCCTGG + Intronic
999466855 5:151815448-151815470 CTTCATGTCCAGAGCTTGAGTGG + Intergenic
1008455782 6:51709086-51709108 CTTGATGCCCTGAACTTTCCTGG + Intronic
1020792203 7:12641149-12641171 CTTGATATGCAGAGCATGCCAGG - Intronic
1021146548 7:17096196-17096218 CTTGATGCCCAGAGCTGGTGAGG - Intergenic
1021555579 7:21914910-21914932 CTTAATGCCCGGTGCCTGCCAGG + Intronic
1022115934 7:27260416-27260438 CTAGATGGCCAGAACTGGCCAGG + Intergenic
1022643034 7:32206136-32206158 CTTGACCCCCAGAGCTTACATGG + Intronic
1024053667 7:45646055-45646077 CTGAATGCACAGGGCTTGCCAGG - Intronic
1030381452 7:108816039-108816061 CTTGCTGCCCACTGCTGGCCTGG + Intergenic
1032674001 7:134111344-134111366 GTTGGTGCCCAGAACTTACCTGG - Intergenic
1035405133 7:158591800-158591822 CTGTATGCCCATAGCATGCCAGG + Intergenic
1035696565 8:1602476-1602498 CATGTTGCCCAGAGCTAGCCAGG + Intronic
1044998658 8:97861073-97861095 CTTGATGCCCAGCTCATACCTGG - Intergenic
1047251468 8:123184513-123184535 CTTCAAGCCCAGAGCTGGGCTGG + Intronic
1048809004 8:138268214-138268236 TTGTATGCCCAGAGCGTGCCTGG - Intronic
1049278469 8:141731836-141731858 ATGGCAGCCCAGAGCTTGCCAGG + Intergenic
1049685467 8:143937581-143937603 CGTGCTGCCCAGAGCTGGCCTGG - Intronic
1050880010 9:10687946-10687968 CATGATGCCCTGAGCTCTCCCGG - Intergenic
1051708123 9:19901954-19901976 CTTGAGGCCCCGTGCTTGCTGGG + Intergenic
1052532411 9:29704600-29704622 CTTTATGTCTAGAGCTGGCCTGG - Intergenic
1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG + Intronic
1055230457 9:74058016-74058038 CTTTCTGCTAAGAGCTTGCCAGG + Intergenic
1056071407 9:82991078-82991100 GGTGAAGCTCAGAGCTTGCCTGG - Intronic
1057618202 9:96612407-96612429 CTTGATGCCCATTGATGGCCAGG - Intronic
1060183640 9:121550915-121550937 CTGGATTCCCAGAGCAGGCCTGG + Intergenic
1060282432 9:122223384-122223406 CTTGAGGAGCAGAGCCTGCCTGG - Intronic
1060940111 9:127538283-127538305 CTGGATCCCCAGAGTTTGCCAGG + Intronic
1061412366 9:130428525-130428547 CTGGAAACCCAGAGGTTGCCAGG + Intronic
1185942599 X:4338413-4338435 CTTGGTGCTCAGATCCTGCCAGG - Intergenic
1186304771 X:8244462-8244484 CTTCATGCCCAGAGATGGGCTGG + Intergenic
1187674082 X:21698438-21698460 CTTCAAGCCCAGGGCTTCCCAGG + Intergenic
1190939383 X:55025953-55025975 AGTGCTGCCCAGTGCTTGCCCGG - Exonic
1190968862 X:55329670-55329692 CATGATGCCCAGAGCTTCAGGGG + Intergenic
1195177613 X:102326320-102326342 CTTGATTCCCAGACCTCACCTGG - Exonic
1195181251 X:102360773-102360795 CTTGATTCCCAGACCTCACCTGG + Exonic
1195203354 X:102571271-102571293 CTTGATTCCCAGATCTCACCTGG - Intergenic
1199353260 X:146830549-146830571 GTTGATGCCCAGTGGTTGACTGG + Intergenic
1200115491 X:153768083-153768105 CTGGATGCTATGAGCTTGCCAGG + Intronic
1200809276 Y:7465363-7465385 CTGGAAGGACAGAGCTTGCCTGG - Intergenic