ID: 935353488

View in Genome Browser
Species Human (GRCh38)
Location 2:102176868-102176890
Sequence CCAGGTGACCTCAGGGATAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935353488_935353492 -7 Left 935353488 2:102176868-102176890 CCTTTATCCCTGAGGTCACCTGG 0: 1
1: 1
2: 0
3: 24
4: 163
Right 935353492 2:102176884-102176906 CACCTGGAATCAGATTATTAAGG 0: 1
1: 0
2: 1
3: 15
4: 138
935353488_935353496 24 Left 935353488 2:102176868-102176890 CCTTTATCCCTGAGGTCACCTGG 0: 1
1: 1
2: 0
3: 24
4: 163
Right 935353496 2:102176915-102176937 CATGACGTCAATAGCAGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 166
935353488_935353497 25 Left 935353488 2:102176868-102176890 CCTTTATCCCTGAGGTCACCTGG 0: 1
1: 1
2: 0
3: 24
4: 163
Right 935353497 2:102176916-102176938 ATGACGTCAATAGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 57
935353488_935353493 -6 Left 935353488 2:102176868-102176890 CCTTTATCCCTGAGGTCACCTGG 0: 1
1: 1
2: 0
3: 24
4: 163
Right 935353493 2:102176885-102176907 ACCTGGAATCAGATTATTAAGGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935353488 Original CRISPR CCAGGTGACCTCAGGGATAA AGG (reversed) Exonic
901799123 1:11697299-11697321 CCAGGTGTCCCCACTGATAAGGG - Intronic
902324178 1:15688101-15688123 CGAGGGGCCCTCTGGGATAATGG - Intronic
902719175 1:18292699-18292721 CCAGATGACCGAAGGGAGAAAGG - Intronic
903655740 1:24947932-24947954 CCAGGTCACCCCAGGAAGAAAGG - Intronic
907795394 1:57711071-57711093 TCTTGTGACCTCAGGAATAATGG + Intronic
915593985 1:156886088-156886110 ACAGGAGGCCACAGGGATAAGGG - Intergenic
917247537 1:173020922-173020944 GCAGGTAACCTCAGGGGTAAGGG - Intergenic
922721021 1:227900426-227900448 CCAGGTCACCTCAAGGACATGGG - Intergenic
922813112 1:228429139-228429161 CCAGGTGTCCTTAGGGCTAACGG + Intergenic
923070829 1:230562913-230562935 CCAGGTGACCCCTGGGAACATGG - Intergenic
923103729 1:230838131-230838153 CCAGCTCCCCTCAGGGCTAACGG - Exonic
924126571 1:240859599-240859621 CCAGGTTAACTAAGGAATAAAGG - Intronic
1067041252 10:42954387-42954409 GCAGGTGGCCTCAGAGAAAAGGG + Intergenic
1067469655 10:46527375-46527397 CCCAGTGACCCCAGGGACAAAGG - Intergenic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1070707025 10:78647182-78647204 CCAGGTGTGTTCAGGGGTAAGGG + Intergenic
1072609066 10:97004650-97004672 CCAGCTGCCCTCAGGGGTACGGG - Intronic
1073319076 10:102603053-102603075 CCAGGTGACCTCAGACAGAGAGG - Intronic
1073907171 10:108295910-108295932 CCAGGTCACCGCAGGGGGAAAGG - Intergenic
1074236819 10:111593042-111593064 CCAGTTGAGCTCAGTGATTAGGG - Intergenic
1074311595 10:112327518-112327540 CCAGTTGACTCCAGGGACAAGGG - Intergenic
1075209810 10:120481353-120481375 CCAGGGGACATCAGGGAGAAGGG + Intronic
1075316154 10:121455211-121455233 ACAGCTGTCCTCAGGGAGAAAGG - Intergenic
1076912648 10:133399417-133399439 CCAGGTCAGCTCAGGGAAGAAGG - Intronic
1077624745 11:3760687-3760709 ACAGGTTACCTCAGGTATACTGG + Intronic
1078007694 11:7544926-7544948 CCAGGGCTCCTCAGGGATATGGG - Intronic
1078364313 11:10693768-10693790 CCAGCTGGCCTCAGGGCTCAGGG + Intronic
1078437854 11:11340230-11340252 ACAGGTGACCAGAGGGATAGAGG + Intronic
1078919598 11:15817234-15817256 CCAGCTGATCTCAGGGTTACTGG - Intergenic
1080566478 11:33514054-33514076 CAAGGTTACCTCAGAGAGAAAGG + Intergenic
1083024900 11:59542551-59542573 ACAGGAGACATCAGGGGTAAGGG - Intergenic
1083610705 11:64002888-64002910 CCAGGTAGCCCCAGGGATCAGGG - Intronic
1085735427 11:79034835-79034857 CCAGATGTCCTGAGGAATAAAGG - Intronic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1088547353 11:110973303-110973325 CCATGTGACCTTGGGAATAAAGG - Intergenic
1089561907 11:119347347-119347369 CCTGCTGTCCTCAGGGAGAAAGG + Intergenic
1089646036 11:119879789-119879811 TCAGGTGACCTCTGGGCCAAAGG + Intergenic
1089767033 11:120775418-120775440 CCAAGTCACATCAGTGATAAAGG - Intronic
1089867417 11:121643620-121643642 CCAGGTAATCCCAGAGATAATGG + Intergenic
1090183424 11:124720186-124720208 CCAGGAGACCTCTGGGTTGATGG - Intergenic
1092009863 12:5100345-5100367 CCCAGTGACCTCAGGAAAAAAGG - Intergenic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1094384722 12:29881709-29881731 CCAGGTTACCTCTGTGATAAGGG + Intergenic
1095983573 12:47985858-47985880 CCATGTGACCTCAGCGATGCAGG + Intronic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1102248678 12:111370986-111371008 CCAGGTGACCTAGGGGCTTAAGG + Intergenic
1102445440 12:112998712-112998734 GCATGTGACCTCAGGGACAGAGG - Intronic
1105668620 13:22588146-22588168 CAAGGTGATCTGAGGGATTAGGG - Intergenic
1106471728 13:30061890-30061912 CCATGTGTCTTCAGAGATAAGGG - Intergenic
1106606643 13:31234910-31234932 CCTGGTGGCCTTAGGGAGAATGG + Intronic
1108133361 13:47328045-47328067 CCAGTTGACCACAGAGATAAGGG - Intergenic
1109228580 13:59727267-59727289 CTATGTGACCTCAGGGATATTGG - Intronic
1111259618 13:85719752-85719774 ACAAGTCACCTCAGTGATAATGG - Intergenic
1112493133 13:99884793-99884815 CCAGCTGGTCTCAGGGATATGGG - Intronic
1112918738 13:104583526-104583548 GGAGCTGACCTCAGAGATAAAGG + Intergenic
1116977270 14:51130412-51130434 CCAGGGTAGTTCAGGGATAAGGG - Intergenic
1117528794 14:56638777-56638799 TCAGGTGACATCAGGGAGCAGGG + Intronic
1122302337 14:100738367-100738389 CCAGGAGGCCGCAGGGCTAAGGG + Intergenic
1122811367 14:104291055-104291077 CCCCGTGACCTCAGGGACCAAGG + Intergenic
1124764751 15:32479960-32479982 CCCTGTGACCTTAGGGAAAATGG - Intergenic
1125277165 15:38005153-38005175 CTAGGTGCCCTTAGGAATAAAGG - Intergenic
1125335939 15:38626374-38626396 GCAGGTGGTCTCTGGGATAAAGG - Intergenic
1126110048 15:45169627-45169649 CCAGGTGGACTAAGGGAGAAGGG - Intronic
1126212974 15:46120593-46120615 CCAGGTGGCCACAGGGCTTATGG + Intergenic
1129189936 15:73931263-73931285 CCATGTGAAGTCAGGGATAGAGG - Intronic
1130613701 15:85383615-85383637 CCAGATGAACTGAAGGATAATGG + Intronic
1132603223 16:783049-783071 CCTGGGGACCTCAGGCACAATGG + Intronic
1133261910 16:4556436-4556458 CCAGGTGTCCTCAAGGACAAGGG - Intergenic
1133762282 16:8808754-8808776 CCGGGTGACCCTAGGGCTAAAGG - Intronic
1134839583 16:17391103-17391125 TCTTGTGACCTCAGGAATAATGG - Intronic
1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG + Intergenic
1137057471 16:35752523-35752545 ACAGGCCACCTCAGGGATGAAGG - Intergenic
1137898014 16:52235025-52235047 CCCAGTGACCTCAGAGATAAAGG + Intergenic
1138514223 16:57527080-57527102 CCAGGTCACCCCAGGGAAGAGGG + Intronic
1139517504 16:67460499-67460521 CCAGGTAAACCCAGGGTTAATGG - Intronic
1142058802 16:88016695-88016717 ACACGTGACCTCAAGGCTAATGG - Intronic
1143256060 17:5558912-5558934 CCAGATGACCTCAGGAAGCATGG - Exonic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1146617081 17:34365435-34365457 CATGTTGACCTCAGGGACAATGG + Intergenic
1147639662 17:41988197-41988219 GCAGGTGACCTCTGGAAAAAAGG - Intronic
1148074711 17:44928642-44928664 CCAGGAGACCTGAGGGGTTATGG - Intronic
1153632016 18:7079766-7079788 CCAGGTGTCTTCAGGGAGATGGG - Intronic
1156016090 18:32548799-32548821 CCAGGGGACCTCTGGGAACAGGG + Intergenic
1160837293 19:1130952-1130974 GCAGGTGCCCTCAGCGATTAGGG + Intronic
1165020556 19:32920815-32920837 CTGGGTGACCTCAGGCTTAATGG - Intronic
1166970363 19:46563107-46563129 CCAAGAGACCTCAGGGAGAAGGG + Intronic
1167086589 19:47314066-47314088 CCAGGTGACGTGAGGCATGACGG - Intronic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
1168650172 19:58087450-58087472 CCAGGTGCCCTCAAGGGTCAAGG + Intronic
926251950 2:11159746-11159768 CCAGGAGACCACAGGGATTCCGG + Intronic
926747013 2:16167095-16167117 CCAGGTTAGCACAGGGATGAGGG + Intergenic
927393077 2:22618228-22618250 GCTGATGACCTCAGGGAAAAAGG + Intergenic
927946586 2:27138394-27138416 ACAGCTGACCTCAGAGATACTGG - Exonic
930702739 2:54475438-54475460 CCATGTGACCACAGAGAGAAGGG - Intronic
931148682 2:59548150-59548172 GCAGTTGACCACAGGGGTAATGG - Intergenic
933293270 2:80461330-80461352 CGAGGTAACATCAGGGATAATGG - Intronic
933833088 2:86226039-86226061 CCAGGAGACCCCAGGGAGAGTGG - Intronic
933996697 2:87675485-87675507 CCAGGAGGCCTCAGGGATCTAGG - Intergenic
934719778 2:96565508-96565530 CCAGATGCCCTCAAGGATATTGG - Intergenic
935353488 2:102176868-102176890 CCAGGTGACCTCAGGGATAAAGG - Exonic
936297156 2:111275425-111275447 CCAGGAGGCCTCAGGGATCTAGG + Intergenic
937025860 2:118696659-118696681 CGAGTTGACCTCAGGGGCAAAGG + Intergenic
937314276 2:120921190-120921212 CCAAGTAACCTGAGGGATAAAGG - Intronic
937936405 2:127249175-127249197 CCAGGTGATCTCAGGAATGGAGG - Intergenic
941652932 2:168112863-168112885 CCAGCTGCCCTGAGGGATCAGGG + Intronic
944534184 2:200693738-200693760 CAAGGAGACCCCAGGGTTAAGGG - Intergenic
946430875 2:219627004-219627026 AGATGTGACCTCAGGGATAGGGG + Intergenic
946456679 2:219832182-219832204 CAAGGTGACCTCATGCATCATGG + Intergenic
947486087 2:230550375-230550397 CCAGGTGACCTCAGGAGCCATGG + Intergenic
948941623 2:241199742-241199764 CCAGGTGACCTCAGGAAGATGGG + Intronic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1170120255 20:12903778-12903800 CCCGTTTACCTCATGGATAAAGG - Intergenic
1171993277 20:31713075-31713097 CTAGGGGAACTCAGGGTTAATGG + Intronic
1172762035 20:37329616-37329638 CCAGCTGACCTCAGGGAGTAAGG - Intergenic
1175442956 20:59003712-59003734 CCATGGGACCTCAGGGAGAGAGG + Intronic
1175544699 20:59770834-59770856 CCAGGTGACAGCAGGGGTAAAGG - Intronic
1175997693 20:62818829-62818851 CCAGGTGACCTCAGGCCTGGGGG - Intronic
1176009765 20:62886695-62886717 CCAGGTGGCTTTAGGGGTAAAGG - Intronic
1178703595 21:34854656-34854678 TCAGGTGACATCTGGGATACTGG - Intronic
1180706155 22:17811155-17811177 GCAGGTGATCTCAGTGATAAAGG - Intronic
1181033426 22:20158822-20158844 CTAGGTGAACTCAGGGTCAAGGG - Intergenic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1183187155 22:36298754-36298776 CCTGGTGACCTCAGGTCTAAAGG + Intronic
1183817161 22:40312216-40312238 CCAGGAGACTTCAGGGCTGAAGG - Intronic
1184818877 22:46893673-46893695 CCAGGTGCCAGCAGGGACAAGGG - Intronic
950568906 3:13788009-13788031 CAAGGCGACCTCAGAGGTAATGG + Intergenic
952627086 3:35418705-35418727 CCAAGAGACCTCACTGATAAAGG + Intergenic
952959209 3:38579301-38579323 CCAGCTGGCTTCAGGGACAAAGG + Intronic
953886840 3:46718902-46718924 TCAGGTGCCCTAAGGGATAGGGG + Intronic
955327939 3:58024097-58024119 CCTGGTGTCCTCAGGGCTATTGG - Intronic
956110106 3:65861663-65861685 CCACTTGACCTCAGTCATAATGG + Intronic
957057705 3:75456805-75456827 CCCAGTGACCTTGGGGATAAAGG + Intergenic
959581886 3:107991077-107991099 CCAGGTCACCTGGGAGATAATGG - Intergenic
961412210 3:126730595-126730617 CCAGCAGCCCTCAGGGATGAAGG + Exonic
961443606 3:126967406-126967428 CCCAGTGACCTGAGGGAAAACGG - Intergenic
961452510 3:127008792-127008814 CCAGGGGACCTCTGTGAGAAGGG - Intronic
961632009 3:128307975-128307997 CCAGGTGACCCCAGGGAACCAGG - Intronic
962069911 3:132022594-132022616 CCAGCTGACCTCAGGCAGCATGG - Intronic
963140389 3:141941948-141941970 CCAGGAGACCCCTGGGGTAAGGG + Intergenic
963795371 3:149625981-149626003 CCAGTTGAGCTCATGGATTAAGG + Intronic
965846927 3:172973842-172973864 CCAGGTGTTCTCAAGGAGAATGG + Intronic
966974181 3:185070528-185070550 CCAGGTGACCTCAGAGTTCACGG + Intergenic
969000519 4:3977218-3977240 CCCAGTGACCTTGGGGATAAAGG + Intergenic
969813398 4:9667634-9667656 CCCAGTGACCTTGGGGATAAAGG - Intergenic
980395680 4:132212109-132212131 CGAGGTGACCACAGAGATCAAGG - Intergenic
986156537 5:5182199-5182221 CCTGGTGACCTCAAGGACATGGG + Exonic
988452162 5:31354197-31354219 CCAGGAGACCTAAGAGATATCGG + Intergenic
990905959 5:60803244-60803266 GCACATGACCTCAGGGAGAAAGG + Intronic
996921325 5:128770866-128770888 ACAGGTGACATCAGGGATGAAGG + Intronic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
999194952 5:149775440-149775462 GCATGTGGCCACAGGGATAAAGG + Intronic
1001696802 5:173676224-173676246 CCAGGTGCCCTCAGATATAAGGG + Intergenic
1002638599 5:180619981-180620003 GCAGGTGACCTCAGGGAGCCTGG + Intronic
1006409105 6:33862028-33862050 CCAGGAGACCTAAGGGAGTAAGG + Intergenic
1009328849 6:62389132-62389154 CCAGGTGACTTCCTGGATTATGG - Intergenic
1011256917 6:85431967-85431989 TCTTGTGACCTCTGGGATAATGG - Intergenic
1011545540 6:88478367-88478389 ACAGGGGACTTCAGGGAAAATGG + Intergenic
1014177837 6:118349505-118349527 CCAGATGACCTCAGGGAGGGCGG + Intergenic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1016010615 6:139134996-139135018 CCAGGTGACCTCACGGCTGACGG - Intergenic
1016320527 6:142839640-142839662 CCTGGTGAACTCAGGGAGCATGG - Intronic
1020127823 7:5542789-5542811 CCAGGTGGCCCCAGGGACAAAGG - Intronic
1020806476 7:12795866-12795888 GCAGGTGACATCAGAGATATGGG + Intergenic
1023079571 7:36514503-36514525 CCAGCTAACATCATGGATAAAGG - Intronic
1023487720 7:40704490-40704512 ACAGGTGACCACAGGGGTAGAGG + Intronic
1034162033 7:149001120-149001142 CCAGTGGGTCTCAGGGATAAGGG - Intergenic
1036533806 8:9624746-9624768 CTAGGTGTCCTCAGGGGTACTGG + Intronic
1039639793 8:39206631-39206653 GAAGGTGACCTCAAGGATGAAGG - Intronic
1040713761 8:50222179-50222201 CCTTGTGACCTCTGGAATAATGG + Intronic
1041053593 8:53960549-53960571 CAAGGTGAACTCAGTGATACAGG - Intergenic
1044690965 8:94878075-94878097 CCAGGTGAGGTAAAGGATAAAGG - Intronic
1045249344 8:100470360-100470382 CCAACTGACCTCAGTGGTAAAGG + Intergenic
1045391615 8:101720886-101720908 CTAGGTGCCCTTAGGGAAAAGGG - Intronic
1047191814 8:122685232-122685254 CCAGGTGACCCCAGAGATAGTGG - Intergenic
1050002812 9:1096690-1096712 GCAGGTGGCCTCAGGTATAGGGG + Intergenic
1051085716 9:13346719-13346741 CTAGGGGACCTCAGAGATCAAGG + Intergenic
1053478877 9:38401490-38401512 GCAGGGGACCAGAGGGATAAGGG + Intergenic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1054984350 9:71244518-71244540 TGAGGTGACTTGAGGGATAAAGG + Intronic
1056829205 9:89900789-89900811 CCAGGTGAGCAAAGGGGTAAGGG + Intergenic
1058489458 9:105481106-105481128 CCAGGTGATCTCAGGAATTAGGG + Intronic
1061407520 9:130400677-130400699 CAAGGTGACATCAGTGACAAAGG - Intronic
1062296905 9:135835431-135835453 CCAGGTGGCCTTAGTGATTATGG + Intronic
1186576851 X:10775801-10775823 CCAGGTGACCTCAGGGACAAAGG + Intronic
1196050437 X:111298380-111298402 CCAGGTGAATGCAGGGAAAAGGG + Exonic
1196111704 X:111953583-111953605 CCTGGAGGCCTCAGGGATGAGGG - Intronic
1196727975 X:118914295-118914317 TCTGGTGACCTCTGGAATAATGG - Intergenic
1196904597 X:120419102-120419124 TCAGGGGACCTCAGGGAGACAGG - Intergenic
1200208615 X:154335312-154335334 CAAGGTTACTTCCGGGATAAAGG - Intergenic