ID: 935357019

View in Genome Browser
Species Human (GRCh38)
Location 2:102210786-102210808
Sequence TCTGGACCTCCACCATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935357019_935357027 13 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357027 2:102210822-102210844 TGTATGGGCATGGAGCTTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 218
935357019_935357025 3 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357025 2:102210812-102210834 GGTCATGGCCTGTATGGGCATGG 0: 1
1: 0
2: 1
3: 10
4: 134
935357019_935357023 -3 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357023 2:102210806-102210828 AGAGTAGGTCATGGCCTGTATGG 0: 1
1: 0
2: 1
3: 2
4: 81
935357019_935357028 17 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357028 2:102210826-102210848 TGGGCATGGAGCTTAGAGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 521
935357019_935357024 -2 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357024 2:102210807-102210829 GAGTAGGTCATGGCCTGTATGGG 0: 1
1: 0
2: 0
3: 4
4: 63
935357019_935357029 22 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357029 2:102210831-102210853 ATGGAGCTTAGAGGAAGGACTGG 0: 1
1: 0
2: 0
3: 22
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935357019 Original CRISPR TCTGGACCTCCACCATCCAA AGG (reversed) Intronic