ID: 935357022

View in Genome Browser
Species Human (GRCh38)
Location 2:102210804-102210826
Sequence ATACAGGCCATGACCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935357022_935357028 -1 Left 935357022 2:102210804-102210826 CCAGAGTAGGTCATGGCCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 935357028 2:102210826-102210848 TGGGCATGGAGCTTAGAGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 521
935357022_935357030 28 Left 935357022 2:102210804-102210826 CCAGAGTAGGTCATGGCCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 935357030 2:102210855-102210877 GACATGACCTTCAAAGTCATTGG 0: 1
1: 0
2: 3
3: 12
4: 133
935357022_935357027 -5 Left 935357022 2:102210804-102210826 CCAGAGTAGGTCATGGCCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 935357027 2:102210822-102210844 TGTATGGGCATGGAGCTTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 218
935357022_935357029 4 Left 935357022 2:102210804-102210826 CCAGAGTAGGTCATGGCCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 935357029 2:102210831-102210853 ATGGAGCTTAGAGGAAGGACTGG 0: 1
1: 0
2: 0
3: 22
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935357022 Original CRISPR ATACAGGCCATGACCTACTC TGG (reversed) Intronic