ID: 935357028

View in Genome Browser
Species Human (GRCh38)
Location 2:102210826-102210848
Sequence TGGGCATGGAGCTTAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935357022_935357028 -1 Left 935357022 2:102210804-102210826 CCAGAGTAGGTCATGGCCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 935357028 2:102210826-102210848 TGGGCATGGAGCTTAGAGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 521
935357019_935357028 17 Left 935357019 2:102210786-102210808 CCTTTGGATGGTGGAGGTCCAGA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 935357028 2:102210826-102210848 TGGGCATGGAGCTTAGAGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935357028 Original CRISPR TGGGCATGGAGCTTAGAGGA AGG Intronic