ID: 935360286

View in Genome Browser
Species Human (GRCh38)
Location 2:102240924-102240946
Sequence CTTGAGACACAGGACAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935360283_935360286 5 Left 935360283 2:102240896-102240918 CCTTGAGAAAGAGATGAACATTT 0: 1
1: 1
2: 3
3: 39
4: 498
Right 935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG 0: 1
1: 0
2: 2
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935360286 Original CRISPR CTTGAGACACAGGACAAACA AGG Intergenic
903722688 1:25417840-25417862 CTTGAGACACAAGACCAGCGTGG - Intronic
904058527 1:27688007-27688029 CTTGGAACACAGGCCATACAGGG - Intergenic
906780255 1:48567033-48567055 CCAGAGAAACAGGACAAATAGGG - Intronic
913275184 1:117130482-117130504 CATGAGCAAGAGGACAAACAGGG - Intergenic
913706523 1:121429772-121429794 GATGAGACAGAGGACAAGCATGG - Intergenic
914288962 1:146254981-146255003 CTTGAGAAACAGCAGAAACTGGG + Intergenic
915697694 1:157761110-157761132 TATCAGATACAGGACAAACATGG - Intronic
916656253 1:166877954-166877976 CTAGAGACAAATGAGAAACAGGG - Intergenic
918078412 1:181188077-181188099 CCTGAGAAACAGAACAAACTGGG + Intergenic
918080909 1:181207057-181207079 CTGGAGACACAGGAGACAGAAGG + Intergenic
919923880 1:202182188-202182210 CCAGAGAAACAGAACAAACAGGG + Intergenic
921313832 1:213871888-213871910 TTGGAGCCACAGGACAAACCAGG + Intergenic
921557557 1:216616758-216616780 CATTAGACACAGGAGATACAGGG + Intronic
922216560 1:223524824-223524846 ATGGAGACAAAGGCCAAACAGGG + Intergenic
1063923810 10:10957743-10957765 TTTGAAAGTCAGGACAAACACGG + Intergenic
1067194626 10:44105784-44105806 CTTGAAACACAGGACAAATAGGG + Intergenic
1068488414 10:57690034-57690056 CTTCAGTCACATGAAAAACAGGG + Intergenic
1072177889 10:92946897-92946919 GTTCAGAAACAGGACAAAGAAGG - Intronic
1073938795 10:108669246-108669268 CTTGAGCCACAGGAGAAAATAGG - Intergenic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1076736777 10:132462528-132462550 CTGGAGACCCAGGTAAAACAAGG - Intergenic
1078091478 11:8267246-8267268 CTTGAGTCACAAGGCAAACTTGG - Intronic
1078877471 11:15412801-15412823 CTTCAGACACAGGAGACACAAGG - Intergenic
1079675061 11:23216923-23216945 CTTGAGACAGAGGACATTGAGGG + Intergenic
1080174279 11:29343266-29343288 CTTGAGACAGAGAAAAAGCATGG - Intergenic
1080227999 11:29982717-29982739 CTAGAGTCAAAGTACAAACAGGG + Intergenic
1080353815 11:31417781-31417803 CTTAAGACAGAGCACCAACATGG - Intronic
1081610869 11:44562578-44562600 CTTGTGACACAAGACAGAGATGG + Intergenic
1082997182 11:59263589-59263611 CAGGAGACACAGGACACACGAGG + Intergenic
1085197641 11:74682117-74682139 CTGCAGACACAGGGCAAATAGGG + Intergenic
1085716222 11:78875964-78875986 CCTGAGGCTCAGAACAAACAAGG - Intronic
1086953228 11:92911750-92911772 CCTGAGACCCAGCACAAACCTGG - Intergenic
1089330831 11:117687983-117688005 CTGCAGACCCAGGACAAGCATGG + Intronic
1089601641 11:119619266-119619288 CTGGTGACACTGGCCAAACAAGG + Intergenic
1089633318 11:119796778-119796800 CTAGAGACCCAGGAGGAACAGGG - Intergenic
1090642064 11:128738347-128738369 CTTGAAATACAAGACAACCAAGG + Intronic
1091028007 11:132159190-132159212 CTTGAGGGGCTGGACAAACAGGG + Intronic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1094281156 12:28740190-28740212 CTCAAGACACAGGACAAAAGAGG - Intergenic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094495131 12:30984508-30984530 CCTGAGACCCAGGCCAGACAAGG + Intronic
1097055245 12:56245238-56245260 GTCAAGACACAGGACAGACAGGG - Intronic
1097530311 12:60791878-60791900 ATTGTGACACTGGACAAATAAGG - Intergenic
1099092506 12:78330851-78330873 TTTGAGGCACAAAACAAACAGGG - Intergenic
1101732127 12:107435529-107435551 CATGAGACAGATGCCAAACAAGG - Intronic
1103141977 12:118556618-118556640 CCAGAGACACAGGACAGGCAAGG + Intergenic
1103706958 12:122880384-122880406 CATGAGACACAAAACACACACGG + Intronic
1106796985 13:33216924-33216946 CTTGGAACACAGGCCATACAGGG + Intronic
1108165696 13:47690700-47690722 ATTGACACACAAAACAAACAGGG - Intergenic
1110704682 13:78591752-78591774 TTTAAGACACATGACAAATATGG + Intergenic
1111894447 13:94123850-94123872 CTTCACACACTGGATAAACAGGG - Intronic
1112094690 13:96119497-96119519 ATTGAGACTCAGGACAAATTTGG + Intronic
1113010190 13:105755870-105755892 CTTGATATACTGGTCAAACAAGG + Intergenic
1113160815 13:107378915-107378937 CCTGAAACACAGAACAATCAGGG + Intronic
1114218085 14:20672693-20672715 CTTGACACACTGGGGAAACATGG + Intergenic
1114363692 14:22003914-22003936 GGAGAGACAAAGGACAAACAAGG - Intergenic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1119350527 14:73961142-73961164 CATCAGCCACAAGACAAACAAGG - Intronic
1119533458 14:75380044-75380066 CTTGGAACACAGGCCATACAGGG - Intergenic
1120019523 14:79512634-79512656 ATTGAGAAATTGGACAAACAAGG + Intronic
1120656963 14:87201927-87201949 TCTGAGACACAGAACCAACATGG + Intergenic
1125792911 15:42383233-42383255 CCTGTGACACAGTTCAAACAGGG - Intronic
1127269095 15:57384834-57384856 CTAGAGACAGAGGAAATACAAGG - Intronic
1129057435 15:72830998-72831020 AGTGACACAGAGGACAAACATGG - Intergenic
1130625601 15:85511230-85511252 CCAGAGAAACAGGCCAAACAAGG - Intronic
1131432826 15:92400480-92400502 CTAGATACACAGGAAAAGCAGGG - Intronic
1132486512 16:195071-195093 CTTCAGACACAGGATGAGCATGG - Intronic
1133363852 16:5195612-5195634 TTGGAGACAGATGACAAACAAGG - Intergenic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1137240207 16:46649521-46649543 CTTGAGTCTCAGGACATCCAAGG - Intergenic
1138157716 16:54721425-54721447 CTTGAGACACTTGACAAATGAGG + Intergenic
1138753073 16:59447671-59447693 CTTGAAAACCAGCACAAACAAGG - Intergenic
1139264307 16:65624696-65624718 CTGGAGACAGAGGAGAAAGAGGG - Intergenic
1139440784 16:66965665-66965687 CTTTGGACACAGGAGAGACAGGG - Intronic
1140776222 16:78250914-78250936 CGTGGAACACAGGCCAAACAGGG - Intronic
1142952710 17:3496736-3496758 CTTGAGCCACATGACAATTATGG + Intronic
1148581574 17:48747505-48747527 CTGGAGGCCCAGGAGAAACACGG - Intergenic
1149482595 17:57015960-57015982 CTTAAGACAGAGTAGAAACAGGG + Intergenic
1151588673 17:75028520-75028542 CTTGGGCCACATGTCAAACAGGG + Intergenic
1152231024 17:79114298-79114320 CTACAGCCACAGGACACACATGG - Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1153943172 18:9994470-9994492 CTCGAGACACAGGGGAAGCAGGG + Intergenic
1154282648 18:13019547-13019569 CTTCAGGCACAGGAGAAACGGGG - Intronic
1154366591 18:13715878-13715900 ATTGAGCCACAGTAGAAACAAGG - Intronic
1156277225 18:35594887-35594909 CTCGAGACAGAGGACAAATCAGG + Intronic
1157427847 18:47599560-47599582 CTTGTTACACACTACAAACAGGG - Intergenic
1163433811 19:17283353-17283375 CTTGAAACTGTGGACAAACATGG + Exonic
1165070742 19:33253620-33253642 CTAGAGAGACAGGACAGCCATGG - Intergenic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1167071053 19:47222096-47222118 CTGGAGGCAGAGGACAAACACGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167647767 19:50715133-50715155 ATCGAGACACAGGACAGACAGGG + Intronic
925296059 2:2778270-2778292 CATGAGACAGAGGACAAACAGGG + Intergenic
926761636 2:16283512-16283534 CTTGTGGCATAGAACAAACACGG - Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927385510 2:22528957-22528979 ATTTAGACACAGTACCAACAGGG + Intergenic
930943615 2:57044339-57044361 CATGTGACACACTACAAACAAGG - Intergenic
931501488 2:62873602-62873624 CTTCAGACTCAGGAAATACAAGG + Intronic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
935571319 2:104663180-104663202 CTTGAGTCACTGGACCAAAATGG + Intergenic
935701342 2:105814790-105814812 CATGAGACACAGGGCACACAGGG + Intronic
936460340 2:112709753-112709775 CATGTGACACAGGACATACAGGG - Intergenic
937064747 2:119009405-119009427 TTTGAGCCTCAGGACAAAAAGGG - Intergenic
937432875 2:121854369-121854391 CTTGAGACACAGCACAGGAAAGG - Intergenic
937530529 2:122821963-122821985 AATGAGAGAGAGGACAAACAAGG - Intergenic
938963853 2:136368517-136368539 CTTGATACAAAAGCCAAACAAGG + Intergenic
938993892 2:136657386-136657408 CTTGAGAGCCAGGAGAAAGAAGG + Intergenic
942427220 2:175872803-175872825 CATGAGACATAGGAGAAACAGGG - Intergenic
942689454 2:178570089-178570111 CTTGAGAAACGGGATAAAGAAGG - Exonic
943049420 2:182896985-182897007 CTTGAGCCACTGGGCTAACATGG - Intergenic
944486910 2:200216506-200216528 CTTGAGATACAGTACAAAATGGG + Intergenic
945908153 2:215617193-215617215 CTTGACTTCCAGGACAAACAAGG + Intergenic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
946573591 2:221050730-221050752 CATGGAACACAGGCCAAACAAGG + Intergenic
947918815 2:233852322-233852344 CCTGTGACACAGGAAACACAGGG + Intronic
948356075 2:237378472-237378494 CTTGAGACACTGTACCAGCAAGG - Intronic
1174336899 20:49868842-49868864 ATTGAGACAGAGGGCAAACCAGG - Intronic
1174484889 20:50855004-50855026 CTTGAGACACACCACGAACCCGG - Intronic
1174540589 20:51286201-51286223 CTTGGGAGACAGGACCAAGATGG + Intergenic
1175480236 20:59305455-59305477 CTAGAGAGACAGAACCAACAGGG + Intronic
1176118666 20:63444435-63444457 CTGGAGACAGATGACAAAGATGG + Intronic
1176978661 21:15353728-15353750 CGTGTGACACAGACCAAACAGGG - Intergenic
1177238937 21:18430730-18430752 CATGAGACACAGGGAAAACAAGG + Intronic
1178811821 21:35890846-35890868 CTTGAGGCACAGTAAAAAGAGGG - Intronic
1179099223 21:38341947-38341969 CTTGAGCCAGAGGACATATATGG + Intergenic
1179199967 21:39207894-39207916 CTGGACACAAAGGACAAATATGG + Intronic
1183696805 22:39428226-39428248 CTGGTGCCACAGGACACACACGG - Intronic
1184276109 22:43410737-43410759 CTAGAGACAAAGGAAAAGCAAGG - Intergenic
1184876426 22:47278815-47278837 CCTGAGACTCAGGACAGCCAAGG - Intergenic
949848099 3:8392624-8392646 CTTGAGACTCAGGTCATAAAAGG + Intergenic
951065171 3:18255781-18255803 CTTGAGATACAGGACACTTATGG + Intronic
951539092 3:23765433-23765455 CTAGAGACACTGAACGAACAGGG + Intergenic
952483814 3:33789332-33789354 CTTAAGACAAAGAACAAAGAGGG + Intergenic
953345241 3:42170125-42170147 CTCAACACACAGGACATACAGGG - Intronic
954418052 3:50403768-50403790 CTTGGGATACAGCACAAACAAGG - Intronic
954438497 3:50508751-50508773 TGTGATACACAGGAAAAACATGG + Intergenic
956311919 3:67890477-67890499 TCTGAGACACAGAAGAAACAAGG + Intergenic
956997830 3:74848281-74848303 CTTCAGACTTAGGACAAACCAGG + Intergenic
958596354 3:96229646-96229668 GTTGAGCCACAGGATCAACATGG - Intergenic
958658881 3:97040254-97040276 CTTGAGACTTAAGACACACAGGG - Intronic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
965256508 3:166420528-166420550 CTTGAAAACCAGCACAAACAAGG - Intergenic
965742194 3:171887089-171887111 TCTGAGGCACAGAACAAACAAGG + Intronic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
968789286 4:2648391-2648413 CATGAGGCACAGGACACAGAGGG - Intronic
968877856 4:3283618-3283640 CTGGAGCCATAGGACAGACAGGG + Intergenic
969967399 4:11011429-11011451 CTTGATAAACAGGACAGACAGGG - Intergenic
971249852 4:24965719-24965741 CTTGAGAAACTCGAAAAACAAGG + Intronic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
976441053 4:85074966-85074988 CTTGAGACACAGGAAACCTATGG + Intergenic
977981058 4:103322387-103322409 CTTGAGGCAGCGGAGAAACATGG + Intergenic
978135777 4:105257586-105257608 CTTGAGACTCTGCACAAGCAGGG - Intronic
980965398 4:139516093-139516115 CATGGGACACAGGAAAAAAAGGG + Intronic
983661962 4:170137567-170137589 CTTGGAATACAGGACGAACAGGG - Intergenic
984274594 4:177594707-177594729 GATGTGACAGAGGACAAACAGGG - Intergenic
986597924 5:9442575-9442597 CATGAGCCACATGGCAAACAGGG + Intronic
988102695 5:26702358-26702380 CTAGAGGGACAGAACAAACAGGG - Intergenic
990054491 5:51554581-51554603 CCAGAGAAACAGAACAAACAGGG - Intergenic
990109977 5:52310693-52310715 TTTGAGACACAGTGGAAACAGGG - Intergenic
990140131 5:52693864-52693886 CATGAGACACTAGACTAACAGGG + Intergenic
992178518 5:74174162-74174184 CTTAAGAAACAGGAAAAAAAAGG + Intergenic
992522013 5:77563693-77563715 CTGCAGACACTGGAGAAACATGG + Intronic
997497347 5:134340307-134340329 CTTAAGACACTGGAAAAAGAAGG + Intronic
998640389 5:144003784-144003806 CTTTAGTCACAGGAAACACAGGG + Intergenic
998815095 5:146006041-146006063 CTAAAGACACAAGACAAACATGG + Intronic
999893007 5:155999551-155999573 AATGATAAACAGGACAAACAAGG + Intronic
1001534346 5:172488355-172488377 CATGAGGAACAGGACAAAGATGG - Intergenic
1001895190 5:175372785-175372807 CTTCAGACATATGGCAAACAAGG - Intergenic
1002548471 5:179968959-179968981 CTGGAGACAAAGGACAAATGGGG + Intronic
1002567385 5:180119565-180119587 CTTGAGGCTCAGGGTAAACAGGG + Intronic
1003234032 6:4280610-4280632 TTTGAGACTCAGAACAAATAGGG - Intergenic
1003338113 6:5194106-5194128 AGAGAGACAGAGGACAAACATGG + Intronic
1003757946 6:9143312-9143334 CCAGAGAAACAGGACCAACAGGG - Intergenic
1009339528 6:62536669-62536691 CTTGAGACACGGAACAGACCTGG + Intergenic
1011272884 6:85597460-85597482 TTTGAGACAAGGGAAAAACAGGG - Intronic
1011545234 6:88475963-88475985 CTTCAGAGAGAGGACAAATATGG - Intergenic
1011620901 6:89241703-89241725 TTTGAGAAAGAGGACTAACAAGG - Intergenic
1011705388 6:89996024-89996046 TTTGAGAAACAGGAAAAAAAAGG - Intronic
1012130567 6:95486608-95486630 TTTGAGAAACATGTCAAACAGGG - Intergenic
1012440519 6:99257915-99257937 CTAGAGACACAGGAGAACCAGGG + Intergenic
1012503087 6:99912322-99912344 CTTGAGACAAAGGACACTCTGGG - Intergenic
1013549528 6:111193619-111193641 TTTGGAACACAGGACAAACTTGG - Intronic
1014401820 6:120999189-120999211 CTGGAGACTCGGGAGAAACATGG - Intergenic
1018104946 6:160476735-160476757 CTTGTGACCCATGACAAAAATGG + Intergenic
1018113064 6:160555629-160555651 CTTGTGACCCATGACAAAAATGG + Intronic
1018116288 6:160589152-160589174 CTTGTTACCCAAGACAAACATGG + Intronic
1018117911 6:160606029-160606051 CTTGAGAAACAGGGCTAACAGGG - Intronic
1018576639 6:165266551-165266573 CTTGAGACCCAGGAAAGCCAGGG - Intergenic
1019296274 7:277057-277079 CTTGAAACACAGCACACACATGG + Intergenic
1019922659 7:4172835-4172857 GTTTGGACACAGGACACACAGGG - Intronic
1020417946 7:7968399-7968421 CTTGAGACACAGGACACATGAGG - Intronic
1022053385 7:26702441-26702463 CTTGAGATACGGTTCAAACATGG - Intronic
1022534291 7:31086165-31086187 CTGCACACACAGGACAAAGACGG - Intronic
1023413027 7:39906621-39906643 CATGAAACTCAGGACAAGCATGG + Intergenic
1023604112 7:41912120-41912142 CTTGGGAAACAGGATAAAAATGG - Intergenic
1024542795 7:50492722-50492744 GAAGAGACACAGGACACACAGGG - Intronic
1025142816 7:56479624-56479646 CTTCAGACTCAGGAGAAATATGG + Intergenic
1025653878 7:63499685-63499707 CAAGAGGCAGAGGACAAACAAGG + Intergenic
1027632123 7:80620104-80620126 CATGAGGCAGAGGAAAAACATGG - Intronic
1030179811 7:106694472-106694494 CATGATACATAGGACAAAGAAGG + Intergenic
1030716379 7:112812614-112812636 CTGAAGACACAGGACAGAAAAGG + Intergenic
1034909612 7:154984892-154984914 CCTGTGACACAGGCCAAATAGGG - Intronic
1035797706 8:2374568-2374590 CATGAGCCAGAGGCCAAACATGG - Intergenic
1036218754 8:6902809-6902831 ATGGAGTCACAGGACAAGCAAGG + Intergenic
1040661193 8:49577765-49577787 CTTGAGGCTCAGGAACAACAAGG - Intergenic
1040979354 8:53229678-53229700 CTTGAGACGCAGGATCATCAGGG + Exonic
1046949669 8:120007897-120007919 CTGGAGACTGAGGAAAAACAGGG - Intronic
1047776913 8:128079206-128079228 CTTGAGATACAGGACATACTAGG - Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048205242 8:132410388-132410410 CTTGAAAACCAGGACAAAGAGGG + Intronic
1050667576 9:7958520-7958542 AATGAGCCACAGGACAGACAGGG - Intergenic
1051043748 9:12848469-12848491 ATTGAGACACAGAACAGGCAAGG + Intergenic
1052790633 9:32872554-32872576 CTTGAGACACTGGGTAAAGATGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1055257420 9:74387682-74387704 CTTGAGTCACAGAGCAAAAAAGG + Intergenic
1055831126 9:80380089-80380111 CTTAAGCCCCAGGAGAAACATGG - Intergenic
1056968011 9:91180309-91180331 TTTCAGACACAGGCCCAACACGG - Intergenic
1057991607 9:99776389-99776411 CCAGACAGACAGGACAAACAAGG + Intergenic
1058878536 9:109266103-109266125 CAAGAGACACAGTATAAACATGG + Intronic
1059654397 9:116344416-116344438 CTTGAGACTGAGGACAGAAAGGG - Intronic
1060849768 9:126864936-126864958 CCTGAGACACAGCTCAAACGAGG - Intronic
1061940360 9:133880616-133880638 CTTGGGACAGAGGACATAAAGGG + Intronic
1185745916 X:2573332-2573354 CTTGAGGCAGAGGTCCAACATGG + Intergenic
1186267785 X:7850562-7850584 CTTCTGGCACAGGAGAAACATGG - Intergenic
1186904798 X:14099689-14099711 GATGAGAGACAGGACAAACTGGG - Intergenic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1190720668 X:53144916-53144938 CTTGAGACACAGAACGACTAAGG - Intergenic
1191118413 X:56875379-56875401 CTTGGAATGCAGGACAAACAGGG + Intergenic
1192139351 X:68634238-68634260 CTTGGAACACAGGACATGCAAGG + Intergenic
1193517521 X:82487109-82487131 CATGAGACACAGCAAGAACAAGG - Intergenic
1194147186 X:90279255-90279277 CTTCAGACAGAGGCCAAAGAGGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1199287529 X:146070393-146070415 CATGAAACACAGGAAACACAGGG - Intergenic
1200366199 X:155667346-155667368 CTGAAGATACAGGACAAATAGGG + Intronic
1200493589 Y:3856023-3856045 CTTCAGACAGAGGCCAAAGAGGG - Intergenic
1201442290 Y:14021305-14021327 TTTGAGAAGCAGAACAAACATGG - Intergenic
1201792998 Y:17862816-17862838 CTAGAGACAGAGGGTAAACAAGG - Intergenic
1201808556 Y:18043170-18043192 CTAGAGACAGAGGGTAAACAAGG + Intergenic
1202354530 Y:24032060-24032082 CTAGAGACAGAGGGTAAACAAGG - Intergenic
1202516248 Y:25638052-25638074 CTAGAGACAGAGGGTAAACAAGG + Intergenic