ID: 935361802

View in Genome Browser
Species Human (GRCh38)
Location 2:102251540-102251562
Sequence CTGTCTTAAGGGAAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935361802_935361809 18 Left 935361802 2:102251540-102251562 CCAGGCACCTTCCCTTAAGACAG No data
Right 935361809 2:102251581-102251603 TCAGTCCTTCACATCACTGCGGG No data
935361802_935361808 17 Left 935361802 2:102251540-102251562 CCAGGCACCTTCCCTTAAGACAG No data
Right 935361808 2:102251580-102251602 TTCAGTCCTTCACATCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935361802 Original CRISPR CTGTCTTAAGGGAAGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr