ID: 935363519

View in Genome Browser
Species Human (GRCh38)
Location 2:102267405-102267427
Sequence CCCTGTGAATGGAGGTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935363519_935363529 1 Left 935363519 2:102267405-102267427 CCTGCTGACCTCCATTCACAGGG No data
Right 935363529 2:102267429-102267451 CACGGAGGGTCCCTTGGGCTTGG No data
935363519_935363531 11 Left 935363519 2:102267405-102267427 CCTGCTGACCTCCATTCACAGGG No data
Right 935363531 2:102267439-102267461 CCCTTGGGCTTGGAGTAAGATGG No data
935363519_935363527 -5 Left 935363519 2:102267405-102267427 CCTGCTGACCTCCATTCACAGGG No data
Right 935363527 2:102267423-102267445 CAGGGGCACGGAGGGTCCCTTGG No data
935363519_935363528 -4 Left 935363519 2:102267405-102267427 CCTGCTGACCTCCATTCACAGGG No data
Right 935363528 2:102267424-102267446 AGGGGCACGGAGGGTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935363519 Original CRISPR CCCTGTGAATGGAGGTCAGC AGG (reversed) Intergenic
No off target data available for this crispr