ID: 935365257

View in Genome Browser
Species Human (GRCh38)
Location 2:102282642-102282664
Sequence TGCTATTTGCTGTAAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365257_935365263 15 Left 935365257 2:102282642-102282664 CCCCTATCTTACAGCAAATAGCA No data
Right 935365263 2:102282680-102282702 ACTCTAACACTGAGCCTGAATGG No data
935365257_935365260 -9 Left 935365257 2:102282642-102282664 CCCCTATCTTACAGCAAATAGCA No data
Right 935365260 2:102282656-102282678 CAAATAGCACCAATCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365257 Original CRISPR TGCTATTTGCTGTAAGATAG GGG (reversed) Intergenic
No off target data available for this crispr