ID: 935365467 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:102285076-102285098 |
| Sequence | GAAGCCTTATGGAGTCCTCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935365467_935365473 | 21 | Left | 935365467 | 2:102285076-102285098 | CCTAGAGGACTCCATAAGGCTTC | No data | ||
| Right | 935365473 | 2:102285120-102285142 | ATACTGTTTTCCAGCCACACTGG | 0: 1 1: 0 2: 7 3: 45 4: 331 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935365467 | Original CRISPR | GAAGCCTTATGGAGTCCTCT AGG (reversed) | Intergenic | ||