ID: 935365468

View in Genome Browser
Species Human (GRCh38)
Location 2:102285087-102285109
Sequence ATGGGGATGGAGAAGCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365468_935365473 10 Left 935365468 2:102285087-102285109 CCATAAGGCTTCTCCATCCCCAT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365468 Original CRISPR ATGGGGATGGAGAAGCCTTA TGG (reversed) Intergenic