ID: 935365469

View in Genome Browser
Species Human (GRCh38)
Location 2:102285100-102285122
Sequence TATGTGCTGCAAGATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365469_935365473 -3 Left 935365469 2:102285100-102285122 CCATCCCCATCTTGCAGCACATA No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365469 Original CRISPR TATGTGCTGCAAGATGGGGA TGG (reversed) Intergenic