ID: 935365470

View in Genome Browser
Species Human (GRCh38)
Location 2:102285104-102285126
Sequence ACAGTATGTGCTGCAAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365470_935365473 -7 Left 935365470 2:102285104-102285126 CCCCATCTTGCAGCACATACTGT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365470 Original CRISPR ACAGTATGTGCTGCAAGATG GGG (reversed) Intergenic