ID: 935365471

View in Genome Browser
Species Human (GRCh38)
Location 2:102285105-102285127
Sequence AACAGTATGTGCTGCAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365471_935365473 -8 Left 935365471 2:102285105-102285127 CCCATCTTGCAGCACATACTGTT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365471 Original CRISPR AACAGTATGTGCTGCAAGAT GGG (reversed) Intergenic