ID: 935365473

View in Genome Browser
Species Human (GRCh38)
Location 2:102285120-102285142
Sequence ATACTGTTTTCCAGCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935365469_935365473 -3 Left 935365469 2:102285100-102285122 CCATCCCCATCTTGCAGCACATA No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365468_935365473 10 Left 935365468 2:102285087-102285109 CCATAAGGCTTCTCCATCCCCAT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365472_935365473 -9 Left 935365472 2:102285106-102285128 CCATCTTGCAGCACATACTGTTT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365471_935365473 -8 Left 935365471 2:102285105-102285127 CCCATCTTGCAGCACATACTGTT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365465_935365473 26 Left 935365465 2:102285071-102285093 CCTAGCCTAGAGGACTCCATAAG No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365470_935365473 -7 Left 935365470 2:102285104-102285126 CCCCATCTTGCAGCACATACTGT No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data
935365467_935365473 21 Left 935365467 2:102285076-102285098 CCTAGAGGACTCCATAAGGCTTC No data
Right 935365473 2:102285120-102285142 ATACTGTTTTCCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935365473 Original CRISPR ATACTGTTTTCCAGCCACAC TGG Intergenic