ID: 935368714

View in Genome Browser
Species Human (GRCh38)
Location 2:102322113-102322135
Sequence CTGGAAATTCAGATAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935368709_935368714 13 Left 935368709 2:102322077-102322099 CCTGGCAGTCTAAAAGCTACAAG 0: 1
1: 0
2: 1
3: 22
4: 96
Right 935368714 2:102322113-102322135 CTGGAAATTCAGATAAGAGTTGG 0: 1
1: 0
2: 5
3: 25
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935368714 Original CRISPR CTGGAAATTCAGATAAGAGT TGG Intronic
900432651 1:2610306-2610328 CTGGGAATTCAGGCATGAGTCGG + Intronic
902765955 1:18615395-18615417 CTGGAAATTCAGAACAGAATAGG + Intergenic
903419833 1:23210730-23210752 GTGGAAACTCAGATGAGAGCTGG - Intergenic
907494885 1:54837031-54837053 CTGGTAATTCAGATATGAGAAGG - Intronic
908347908 1:63254113-63254135 GTGGACATTCAGCTAAGAGTTGG - Intergenic
911833741 1:102589034-102589056 CTGGAAGCTCAGATAATTGTTGG - Intergenic
911911616 1:103644382-103644404 TGGGAGATTTAGATAAGAGTGGG + Intergenic
911916838 1:103707568-103707590 TGGGAGATTTAGATAAGAGTGGG - Intronic
911919031 1:103738520-103738542 TGGGAGATTTAGATAAGAGTGGG + Intronic
912211168 1:107558659-107558681 GTCAAAATTCAGATCAGAGTGGG + Intergenic
912628716 1:111228254-111228276 CTGGGAATTGGGATGAGAGTGGG + Intronic
913353520 1:117890664-117890686 CTGGAATTCCAGATAACGGTGGG - Intronic
916634506 1:166653811-166653833 CAGGAAATTCAGAAAAGAGTTGG + Intergenic
919621784 1:199871673-199871695 CTATAATTTCAGATAAGTGTTGG - Intergenic
921384801 1:214557898-214557920 CTGGAAAGTCAAATAAGAACAGG + Intergenic
921502833 1:215926915-215926937 CTGGCAAGTCAGATAAGAATAGG - Intronic
921896835 1:220410595-220410617 CAGAAAATTCAGATAATAATTGG - Intergenic
922069958 1:222182513-222182535 CTGCAATTTAAGATAAGATTTGG - Intergenic
922486163 1:225974819-225974841 CTGGAAATTCAGAGAAAAAGTGG - Intergenic
922623845 1:227017007-227017029 CTGAAACATCAGATAATAGTCGG - Exonic
923615743 1:235535592-235535614 TCAGAATTTCAGATAAGAGTTGG - Intergenic
924887361 1:248233710-248233732 CTGGAAATTCAAAAAAAATTTGG + Intergenic
1063219449 10:3952848-3952870 ATGGAGATTCACATATGAGTCGG - Intergenic
1065906905 10:30263038-30263060 CTGCAATTTCAGATGAGATTTGG - Intergenic
1066535894 10:36390990-36391012 CAGGAAATTCATAAAAGTGTTGG + Intergenic
1068431841 10:56943117-56943139 CTGGAAATTCAGAAATGAAGAGG - Intergenic
1068749704 10:60577882-60577904 CTGGAAATTCAGATAGGTGTGGG + Intronic
1068966213 10:62914458-62914480 ATAGAAATTCAGATTAGAGGAGG - Intronic
1069177728 10:65314292-65314314 ATGGAAATTCAAAGAACAGTAGG + Intergenic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1071169009 10:82841553-82841575 CTGGAAATTCAGGCAGGAGTTGG + Intronic
1071801718 10:89070506-89070528 CTGGAAACTCAGGCAAGAGTTGG - Intergenic
1073257342 10:102161438-102161460 CAGGAAATTCAGATCAGCCTGGG - Intronic
1073343317 10:102762700-102762722 ATGCAATCTCAGATAAGAGTAGG - Intronic
1073488291 10:103835683-103835705 CTGGAAAATCAGCGAAGACTTGG - Intronic
1073555731 10:104449084-104449106 GTGGAATTTCCTATAAGAGTAGG - Intronic
1073670484 10:105582093-105582115 ATGCAAATTCACAGAAGAGTGGG + Intergenic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074743895 10:116511762-116511784 GTGGAAATTCTGATAAAAGGGGG - Intergenic
1075565168 10:123497908-123497930 TTGGAAATTCAGATTGGACTTGG - Intergenic
1075909240 10:126109127-126109149 CTGGAAGGTCAGATTAGAGAGGG - Intronic
1077065487 11:639349-639371 CTGGAACTACCCATAAGAGTGGG + Intronic
1079361378 11:19773195-19773217 CTGAAAATTCAGAGAAGCATGGG + Intronic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1084356224 11:68640613-68640635 TTGGACATTCAGATAAGAGAAGG - Intergenic
1084383786 11:68829522-68829544 CTGGAAAGGCAGAAAAGAGGAGG + Intronic
1086027949 11:82317789-82317811 CTGGAAATTGAGATAAAAATGGG + Intergenic
1089035378 11:115384326-115384348 CTGCAAATGGAGAAAAGAGTTGG - Intronic
1089043826 11:115481302-115481324 CAGGGAATTCAGATAAGATAAGG - Intronic
1089237248 11:117040728-117040750 CTGGGAATGTAGATAAGATTAGG + Intronic
1089393239 11:118116280-118116302 CTGGAAATGGAGGTGAGAGTAGG - Intronic
1089927369 11:122272592-122272614 TGGGAACTTCAGATAGGAGTGGG - Intergenic
1091026342 11:132144775-132144797 CTGGCAATGCAGATGAGAGGTGG - Intronic
1091389018 12:114215-114237 CTAGAAATTCAGATATGACTAGG + Intronic
1093017803 12:14171985-14172007 CTGGAGATTAAGATATGAGGAGG - Intergenic
1093668513 12:21843870-21843892 CTGGAAAGTCAGAAAAGACAAGG + Intronic
1094368787 12:29713189-29713211 CTGGAAATTCAGGCAGCAGTTGG - Intronic
1094443716 12:30507374-30507396 CTGGGACTTCAGATAGGCGTCGG - Intergenic
1096889302 12:54750669-54750691 CTGGAAAGACAAATAGGAGTAGG - Intergenic
1099158675 12:79211957-79211979 CTGCAAATTAAAATAACAGTGGG - Intronic
1099175776 12:79420156-79420178 CTAGATATTTACATAAGAGTGGG + Intronic
1099248504 12:80222710-80222732 CTAGAAATTCAGAAGATAGTAGG - Intronic
1105259986 13:18772059-18772081 CTGGACATTCTGATATGATTGGG - Intergenic
1105998361 13:25694493-25694515 CAGGAAATTCAGGTAAGTCTGGG - Intronic
1106853717 13:33823757-33823779 CTGCACATTGAGAAAAGAGTGGG + Intronic
1108160975 13:47638764-47638786 CTAGAAATTCAAATAAGAGATGG + Intergenic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109228500 13:59726447-59726469 TAGGAAAGTCAGATAAGAGCAGG - Intronic
1110387509 13:74931322-74931344 CTGGAAATTGAGCTAAGAAGAGG + Intergenic
1111255251 13:85659290-85659312 CTTGAAACTCAGAGCAGAGTTGG + Intergenic
1111385734 13:87524901-87524923 CTAGAAATGTAGATATGAGTAGG + Intergenic
1111473164 13:88712177-88712199 TTGCAAATTGAGATTAGAGTTGG - Intergenic
1111789316 13:92833082-92833104 CTGGAAATTAAAATAAAAGCTGG + Intronic
1113052005 13:106222801-106222823 CTAGAAATTCAGAGAAGTCTGGG - Intergenic
1113681344 13:112247266-112247288 CTGGAAACTCAGGCAAGAGCTGG + Intergenic
1116301705 14:43191593-43191615 CAGAGAATTCAGATAAGAGATGG + Intergenic
1116374359 14:44179392-44179414 CTGGAAATGAGGATAAGATTAGG + Intergenic
1117909332 14:60621744-60621766 CTGGAACTGCTGAAAAGAGTAGG - Intergenic
1118102300 14:62620472-62620494 ATGGAAAATGAGATAGGAGTTGG + Intergenic
1118123450 14:62872420-62872442 CTGGAATTACAGGCAAGAGTAGG - Intronic
1119565907 14:75629328-75629350 CTGGCAATTCAGTTTAGAGGGGG + Intronic
1120508853 14:85387769-85387791 CTGAAAATACAGGTATGAGTAGG + Intergenic
1122760791 14:104023939-104023961 CTGGAGATTGGGAAAAGAGTTGG + Intronic
1123877664 15:24639928-24639950 CTGGAAATGCAGAAATCAGTTGG + Intergenic
1124642063 15:31401952-31401974 CTGGCAATTCTGCTGAGAGTTGG - Intronic
1126878170 15:53066471-53066493 CTGGAGATTCAGATAGGCCTGGG - Intergenic
1127414614 15:58745871-58745893 TTGGAAATCCAGATACTAGTGGG - Intronic
1128826459 15:70722052-70722074 CTGAAAACTCAGATAAGGGATGG + Intronic
1129406211 15:75320267-75320289 CTAAAAATTCAGAAACGAGTTGG + Intergenic
1130564808 15:84984392-84984414 CTGGAAATTCATGTTAGAGAAGG + Intronic
1131598154 15:93820439-93820461 CTGAAAATTCAGATACGTTTTGG - Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138503232 16:57461939-57461961 CAGGAAATACATTTAAGAGTTGG - Intergenic
1141786004 16:86201299-86201321 ATGGAAATTCAGCTAGAAGTTGG - Intergenic
1141866156 16:86751571-86751593 CTGGAAAATCAGATAATTGAGGG - Intergenic
1142140622 16:88471198-88471220 CTGAGAATTCAGACAAGAGCCGG + Intronic
1142990581 17:3728027-3728049 CTGCAAATTAAAATCAGAGTAGG + Intronic
1145212953 17:21028674-21028696 CCTGAAATTCAGAGAAGAGGAGG + Exonic
1145882352 17:28361403-28361425 TTGGAAATTCACAGAAGATTAGG - Exonic
1147699717 17:42385620-42385642 CTTGACATTCAGATATGAGGTGG - Intronic
1148848798 17:50544248-50544270 CTTGAAATTGAGGTAAGAGCTGG - Intronic
1149035836 17:52133426-52133448 CTGGAAAGTCAGTGAAGAGGTGG + Intronic
1150862423 17:68814908-68814930 CTGGGAAAACAGATAAGTGTAGG + Intergenic
1153536987 18:6112647-6112669 CTGGAGATTCAGACAAAAATTGG - Intronic
1153911520 18:9709265-9709287 CTGGGAATTCAGATAAACGTAGG + Intronic
1154426042 18:14272742-14272764 CTGGACATTCTGATATGATTGGG + Intergenic
1154431057 18:14308671-14308693 CTGGACATTCTGATATGATTGGG + Intergenic
1155031646 18:21990221-21990243 CTGGAAGCTCAGAGAAGAGACGG - Intergenic
1155050919 18:22147005-22147027 CTGGAAGTTCAGAGCAGAATTGG - Intergenic
1156884125 18:42114246-42114268 CTGAGAATTCAGATAAGTTTTGG - Intergenic
1157081703 18:44532642-44532664 CTATAAACTCAGATCAGAGTGGG + Intergenic
1158434494 18:57426440-57426462 CTGAAACTTCAGATAGGAGCTGG + Intergenic
1159349146 18:67249297-67249319 CTGCAAAGTCTAATAAGAGTGGG + Intergenic
1159572733 18:70137685-70137707 ATGGAATTTCAGAAATGAGTAGG - Intronic
925822673 2:7815801-7815823 GTGGAAAATCAGATAAAATTTGG - Intergenic
926596872 2:14800206-14800228 GTGGAAATTCAAATGAGATTTGG - Intergenic
928410635 2:31051522-31051544 CTGGAAGGGCAGGTAAGAGTTGG - Intronic
929334863 2:40729904-40729926 CTGGAAACTCAGGCAGGAGTTGG + Intergenic
929808974 2:45171883-45171905 CTGCAAATTCAGGTAACACTTGG - Intergenic
931249358 2:60516302-60516324 CTGGAAACTCAAAAAAGACTTGG + Intronic
931712315 2:64998897-64998919 CGGGAAGTTCAGAAAAGAGTTGG - Intronic
933094109 2:78156713-78156735 CTGGAAATTCTGGCAAGAATGGG + Intergenic
935368714 2:102322113-102322135 CTGGAAATTCAGATAAGAGTTGG + Intronic
935439745 2:103078073-103078095 CTAGATATTCACAGAAGAGTTGG - Intergenic
936655830 2:114485820-114485842 GTGGAAGTTCAGATAATTGTGGG - Intronic
939095341 2:137827443-137827465 CTGGTCCTTCAAATAAGAGTTGG + Intergenic
939807950 2:146796780-146796802 ATGGAATTTCAGATAAGCTTTGG - Intergenic
940865871 2:158817452-158817474 CAGGAAATTCAGAGAAAAGGTGG + Intronic
941608076 2:167625102-167625124 CTGGAACTTCAGAAAAAAATTGG + Intergenic
944270585 2:197781280-197781302 CAGGAATCTGAGATAAGAGTTGG + Intronic
945271407 2:207944009-207944031 CTGGAGCTGCAGATAAAAGTAGG + Intronic
945716459 2:213363629-213363651 GTGGAAAATGAGCTAAGAGTTGG + Intronic
946141075 2:217691187-217691209 CTGGTAATTCATATGAGAGCTGG + Intronic
947098015 2:226588658-226588680 CTAGAGATACAGAGAAGAGTGGG - Intergenic
947479353 2:230483710-230483732 CTGAAAATGCAGATACGTGTGGG + Intronic
947629578 2:231643363-231643385 GTGGAAATTCAGACAAGAAGAGG + Intergenic
1169068884 20:2709664-2709686 CTGGAAGCTCAGAGGAGAGTGGG + Intronic
1169912982 20:10662283-10662305 CTGGAAATGCAGACAACTGTGGG + Intronic
1170130040 20:13009401-13009423 CAGGTAATTCAGAGAAGAGTAGG - Intronic
1170877679 20:20266045-20266067 CAGGAAATGCAGCAAAGAGTAGG + Intronic
1171023482 20:21608079-21608101 CTGGAAAGGCAGCCAAGAGTGGG - Intergenic
1174896405 20:54454079-54454101 ATGGAAATTAAGATGAGATTTGG - Intergenic
1174988019 20:55477319-55477341 CTGGAAAATTAGCTAAGATTAGG + Intergenic
1176848724 21:13896641-13896663 CTGGACATTCTGATATGATTGGG - Intergenic
1177485954 21:21756316-21756338 CTGGAAATTCAGGTAAAGGTTGG + Intergenic
1177809083 21:25905472-25905494 CTGTAAAATAAGATAAGATTGGG - Intronic
1179373271 21:40826513-40826535 GTGGAAATTCAGCTGTGAGTTGG + Intronic
1179952873 21:44721116-44721138 CTGGAGATCCAGGCAAGAGTTGG - Intergenic
1180856995 22:19053826-19053848 TGGGAAATTCAGATGAGAGATGG + Intronic
1180899641 22:19361058-19361080 CTGGCAATTTCGCTAAGAGTTGG + Intronic
1181818678 22:25459026-25459048 CTGCAAAGTCAAAGAAGAGTTGG - Intergenic
1182994971 22:34803553-34803575 CTGGAAATCCAGGTATCAGTGGG + Intergenic
1184109838 22:42388170-42388192 CTTTAAAGTCAGACAAGAGTAGG + Intronic
1184984224 22:48118515-48118537 CTGGAAATTCAAGAAAGAGGGGG + Intergenic
949371347 3:3337923-3337945 ATGGTAACTCAGATCAGAGTTGG - Intergenic
950683101 3:14598706-14598728 ATGGAAAGTCAGATCAGTGTAGG - Intergenic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
951594944 3:24308152-24308174 CTGGAACTTAAAATAAAAGTTGG + Intronic
951595212 3:24311446-24311468 CTGGAAATTCTGAAAATAGATGG - Intronic
951906581 3:27713299-27713321 ATGGACATTCAGCTAACAGTAGG - Intergenic
952668730 3:35939880-35939902 GTGGGAATTCAGAGAAGAGAGGG - Intergenic
954763103 3:52891368-52891390 CTGGGAACTCAGTGAAGAGTAGG + Intronic
956245862 3:67182137-67182159 CTTCAAATTCAGTTAAGGGTAGG + Intergenic
956937340 3:74118119-74118141 GGGAAAATTCTGATAAGAGTTGG + Intergenic
957362371 3:79175821-79175843 TTGGAAAGGCAAATAAGAGTGGG - Intronic
957605001 3:82387059-82387081 CTGGCAATTTAGATGAGAGCAGG - Intergenic
959258273 3:104042497-104042519 CTGGAAACCCAGATAGGAATTGG - Intergenic
961708416 3:128807765-128807787 CTGGCTATACAGAAAAGAGTGGG - Intronic
961793108 3:129390650-129390672 CTGGAAAATCAGAAAAAAGTGGG - Intergenic
962025632 3:131544497-131544519 CTGGGAATTCAGCTAGGACTAGG - Intronic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963584341 3:147165190-147165212 CTGGAACTTAAAATAAAAGTTGG + Intergenic
963942767 3:151111548-151111570 ATGGAGATGCAGACAAGAGTGGG - Intronic
965034450 3:163419507-163419529 CTAGGAACTCAGATAAGAGAAGG - Intergenic
967644540 3:191905949-191905971 CTGGGAATTCAGGTAAGCATAGG - Intergenic
970558358 4:17258486-17258508 CTGGGAATTCAGAGGAGAGATGG - Intergenic
970949625 4:21738768-21738790 CTGGAAATTGAGAAGAAAGTGGG - Intronic
971594637 4:28513938-28513960 TTGGAAAGTCAGATAATAGATGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
973575907 4:52289056-52289078 CTGGAAATGCACATCAGAATTGG - Intergenic
973713341 4:53650847-53650869 CAGGGAATACAGATAAGAGGAGG - Intronic
974126803 4:57706811-57706833 CTGCAAATTCAGGTGAGAGGGGG + Intergenic
974449817 4:62039654-62039676 CTGAATTTTCACATAAGAGTGGG + Intronic
975841027 4:78474392-78474414 ATGAAAATTCAGATAAAAATTGG + Intronic
977148793 4:93481933-93481955 CTTGAAATTCAGATTACAGAAGG + Intronic
977403860 4:96570602-96570624 CTGGAAATTTGGTTAGGAGTTGG + Intergenic
977899440 4:102402502-102402524 CTGGAAATGCAAATAATACTTGG - Intronic
979041597 4:115804847-115804869 CTTGTAATTGATATAAGAGTTGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
980203833 4:129691859-129691881 ATGAAAATTCAGATGAGATTTGG + Intergenic
982753676 4:159192751-159192773 ATGGAATTTCAGATAAAAGTAGG - Intronic
983098279 4:163592613-163592635 CTGTGAATTCAAATAAGACTTGG - Intronic
983109878 4:163736525-163736547 CTGAAACTGCAGATAAGGGTTGG + Intronic
983524025 4:168742007-168742029 CTGGAAAGTCAGAAACAAGTGGG - Intronic
983527351 4:168772718-168772740 CTGGAAATACAGAGATGAATGGG - Intronic
984722012 4:182981827-182981849 CTGGACATTCAAAGAAGAATTGG + Intergenic
985733596 5:1565013-1565035 CTGGAAATCCAGACAACACTGGG - Intergenic
985922785 5:2992633-2992655 CTGGAAACTCAGGCAGGAGTTGG - Intergenic
986078175 5:4359715-4359737 CTGGAACTTAAAATAAAAGTTGG + Intergenic
986624680 5:9712624-9712646 CTGGAAATTCAGGTATGAGTTGG - Intergenic
988065270 5:26224144-26224166 CTGGAGATCCAGGGAAGAGTGGG - Intergenic
988657139 5:33224969-33224991 CTGGAACTTAAAATAAAAGTTGG - Intergenic
989721742 5:44537108-44537130 ATGGAAATTCAGTTAACAGTTGG - Intergenic
990118684 5:52422192-52422214 CTGAAATTTCTGATAAGTGTTGG - Intergenic
990917393 5:60924556-60924578 CTGGAACTTTATATAAGAGGGGG - Intronic
991494069 5:67210651-67210673 TTGGAAATGCAGGTGAGAGTGGG - Intergenic
992759747 5:79940653-79940675 CTGGAAATTTAGAAAACAGCAGG + Intergenic
993423669 5:87734645-87734667 CTGGAAACTGAGAAAAGGGTTGG + Intergenic
993463797 5:88219432-88219454 ATGGAAATAGAGAAAAGAGTAGG + Intronic
994764660 5:103900893-103900915 CTGCAATTTAAGATGAGAGTTGG - Intergenic
997549536 5:134739592-134739614 CTGGAAACTTAGATAACACTAGG - Intronic
997941112 5:138158385-138158407 CTGGAATTACAGATAAGCTTAGG - Intronic
998507201 5:142681555-142681577 TTGGAAATTCTGCTAAGAGATGG - Intronic
998695477 5:144633301-144633323 ATGGGAATTCAGATGAGATTTGG - Intergenic
999691999 5:154156127-154156149 CTGGAACTTCACAAAAGAGGAGG + Intronic
999703874 5:154253793-154253815 GAGGAATTTCAGATAAAAGTAGG - Intronic
1001068783 5:168564981-168565003 CTAGAAATTTAGATGAGACTAGG - Intronic
1003694425 6:8389189-8389211 CTGGAAATTTAGGGGAGAGTGGG - Intergenic
1004092787 6:12521832-12521854 CTGGAACCTAAGATAAAAGTTGG - Intergenic
1004129769 6:12908607-12908629 CTTGAAAGGCAGATAAGAATGGG + Intronic
1007537024 6:42601267-42601289 CTGGGGATTCAAACAAGAGTAGG - Intronic
1008320001 6:50099815-50099837 ATGGAAATTCAGATAAATCTTGG + Intergenic
1009560256 6:65232117-65232139 TTGGAACTTCAGAAAAGAGAAGG - Intronic
1010285981 6:74078520-74078542 CTGGAACTTAAAATAAAAGTTGG + Intergenic
1011079740 6:83476544-83476566 CTGGAAAATCAGCTAAGTGGAGG + Intergenic
1011239836 6:85259152-85259174 CTGGAAAAGGAGTTAAGAGTTGG + Intergenic
1011305380 6:85920142-85920164 TTGGAAATTTAGGTAAGAGTTGG - Intergenic
1012355218 6:98306208-98306230 TTGGAAATTCAGAAAAGGCTTGG + Intergenic
1013072417 6:106741109-106741131 CAGCAAATTCAGAGAAGACTGGG - Intergenic
1015142337 6:129949435-129949457 CTGGAAATTTATGGAAGAGTTGG - Intergenic
1016225626 6:141732457-141732479 CTGGAAATTGAGAAAAGAAAAGG - Intergenic
1024443659 7:49452265-49452287 CTAGAAATTCAGATGAAAGCAGG + Intergenic
1026154600 7:67816133-67816155 CTAGAAATCCAGATAAGATATGG + Intergenic
1026213218 7:68325052-68325074 TTTGAAATTCAGATATGAGAGGG + Intergenic
1026500898 7:70942625-70942647 CAGGAACTTCAAAAAAGAGTCGG + Intergenic
1028687037 7:93601869-93601891 CTAGATATCCAGATATGAGTTGG + Intronic
1029846069 7:103413556-103413578 CTGTACCTTCTGATAAGAGTCGG - Intronic
1030918879 7:115354181-115354203 ACTGAAATTCAGAAAAGAGTTGG + Intergenic
1031507069 7:122598258-122598280 CTGGGTATTCACATAAGAGTTGG + Intronic
1031649905 7:124276056-124276078 ATGTAAATTCAGACAAAAGTAGG - Intergenic
1032571151 7:132999157-132999179 CTGGAAATGCAGATAAATATTGG - Intronic
1034231916 7:149536687-149536709 GTCGAAATTCAGGTTAGAGTTGG - Intergenic
1036630418 8:10510201-10510223 CTTGAAATTTAAATCAGAGTAGG + Intergenic
1037560024 8:20065381-20065403 CTGGAGATTCAGGAAAGAGTTGG + Intergenic
1038067743 8:23980981-23981003 CTGCAAATTAACATCAGAGTTGG + Intergenic
1039532140 8:38272312-38272334 TTGAGAATTAAGATAAGAGTGGG + Exonic
1040762009 8:50858938-50858960 CTTGAAATTCAGATATGATGTGG + Intergenic
1041181134 8:55249431-55249453 CTGGCAATTCAGATTCGACTAGG - Intronic
1041585519 8:59512850-59512872 CTACAATTTCAGATAAGATTGGG + Intergenic
1042345780 8:67726262-67726284 ATGGAAAGTCAGAAAAGATTAGG + Intronic
1042483234 8:69326007-69326029 CTGGAGATCCAGGGAAGAGTTGG + Intergenic
1042793826 8:72638322-72638344 ATGGAAATTCACAAAAGATTGGG + Intronic
1043214248 8:77565629-77565651 CTGGAAATGAAGGTAAAAGTTGG - Intergenic
1045012387 8:97969473-97969495 CAGGAAATTACGATAATAGTAGG - Intronic
1045909332 8:107387904-107387926 CTGAAAATTTAGAAAGGAGTTGG - Intronic
1048216825 8:132503263-132503285 CTGAATATTGAGATAAGAGTTGG + Intergenic
1048856650 8:138692520-138692542 CTGGAAAATCAGGTAAGAAGTGG + Intronic
1049305103 8:141898572-141898594 CTGGTAGTTAAGACAAGAGTAGG + Intergenic
1049417707 8:142503118-142503140 CTGCAAATTCACCTAAGAGCTGG - Intronic
1050701916 9:8349315-8349337 TTGGAAATTCAAACAAAAGTAGG - Intronic
1051023665 9:12578075-12578097 CAGGGAGTTCAGAGAAGAGTGGG + Intergenic
1051389267 9:16546338-16546360 CTGGATATTGAGACAAGATTGGG - Intronic
1051433840 9:17009214-17009236 CTGTGAAATCAGATAAGAATCGG - Intergenic
1051557216 9:18397830-18397852 CTGGAAATCCAGTTTGGAGTAGG - Intergenic
1056278754 9:85019162-85019184 CTGGATATTGAGATTAGAATTGG + Intronic
1058006561 9:99922391-99922413 TTGGAAATACAGATAGGCGTTGG - Intronic
1059575312 9:115481798-115481820 CTGGGAATTCAGACATGATTGGG - Intergenic
1061503391 9:131016516-131016538 CTGGGAATTCAAATAAGGGAAGG + Intronic
1186355571 X:8785864-8785886 CTGTAAATTTATAGAAGAGTGGG + Intergenic
1186570494 X:10710161-10710183 CAGGAAATTCAGATGGGGGTTGG + Intronic
1188596980 X:31913458-31913480 CTGTATATTCACATAAGAGCAGG - Intronic
1189604765 X:42664961-42664983 CTGGGAAACCAGATAAGGGTAGG - Intergenic
1191025557 X:55909187-55909209 CTGGAAATTCAATTATGAGAAGG + Intergenic
1191703590 X:64069602-64069624 CTGGAGTTTCAGATAAGTGAAGG - Intergenic
1192217269 X:69169992-69170014 CTGGAAAATCACATAATATTTGG - Intergenic
1193797617 X:85895680-85895702 CTAGAAATGCACATAAAAGTAGG - Intronic
1194069705 X:89306169-89306191 TTTGAAATACAGATAACAGTTGG - Intergenic
1194441002 X:93933999-93934021 CTGGAAATTCAGAAAATTTTAGG + Intergenic
1195031898 X:100934359-100934381 CTGGAAATTCAGAAAAGAGATGG + Intergenic
1195617729 X:106926371-106926393 CTGGAAATTCAGATTTGGGAGGG + Intronic
1196195404 X:112833672-112833694 CGGGAAATTCAAATAAGCTTTGG + Intronic
1196947939 X:120846855-120846877 CTAGACATTCAAATAAGAATTGG - Intergenic
1197024365 X:121729867-121729889 CAGGAAATTTAGACAAGAGAGGG + Intergenic
1197309491 X:124886830-124886852 CAGGAAATTGAGAGAAGAGATGG + Intronic
1198014242 X:132592493-132592515 CTAGAAATTCAGACAAAAGTAGG - Intergenic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1199309627 X:146307751-146307773 CTGGAAAGGCAGCTAGGAGTGGG + Intergenic
1199370496 X:147042383-147042405 CTGGAAATCCAGGTAGAAGTCGG + Intergenic
1200723852 Y:6640310-6640332 TTTGAAATACAGATAACAGTTGG - Intergenic
1201981036 Y:19910669-19910691 CTGAAAACTCAGGTAAGAGTGGG - Intergenic