ID: 935369785

View in Genome Browser
Species Human (GRCh38)
Location 2:102333136-102333158
Sequence AGAACCTAGGTCAAATCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935369785_935369789 6 Left 935369785 2:102333136-102333158 CCCCTTGATTTGACCTAGGTTCT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 935369789 2:102333165-102333187 ATCTCCAGAGTGTCTGTTTTAGG 0: 1
1: 0
2: 2
3: 32
4: 311
935369785_935369792 22 Left 935369785 2:102333136-102333158 CCCCTTGATTTGACCTAGGTTCT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 935369792 2:102333181-102333203 TTTTAGGAATATACTTAAGAGGG 0: 1
1: 1
2: 4
3: 45
4: 386
935369785_935369791 21 Left 935369785 2:102333136-102333158 CCCCTTGATTTGACCTAGGTTCT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 935369791 2:102333180-102333202 GTTTTAGGAATATACTTAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935369785 Original CRISPR AGAACCTAGGTCAAATCAAG GGG (reversed) Intronic
901254991 1:7816243-7816265 AGAAACTAAGTTAAATCAAAGGG + Intronic
905769282 1:40626902-40626924 AGAATCTAGGTAAAATCCATAGG - Intronic
912489639 1:110054982-110055004 AGGGGCTAGGTCAAAGCAAGGGG + Intronic
914904489 1:151732625-151732647 AGAAGGTAGGACAAATCAAAGGG + Intergenic
920861830 1:209715078-209715100 AGAACCTAGGTGGGATGAAGAGG + Intronic
923228005 1:231957130-231957152 ACAACCCAGGTCCAATCAAGCGG - Intronic
923321157 1:232834892-232834914 AGCTCCTAGGTCAAACCAAATGG - Intergenic
1067915476 10:50393322-50393344 AGAAACCAGGTCAAGTCAACAGG + Intronic
1068707893 10:60097215-60097237 AGAACCTAGGTCTAGGAAAGGGG + Intronic
1072639320 10:97199571-97199593 AGAACCTCGGGCAAATCAAGAGG - Intronic
1076486679 10:130824772-130824794 AGGACCTAGGACAAAGCCAGGGG + Intergenic
1078692376 11:13595127-13595149 AAAACCTAGGTAAAACCAAAGGG + Intergenic
1083203280 11:61132587-61132609 AGACCCTGGGGAAAATCAAGAGG - Intronic
1087369230 11:97260109-97260131 AGAATCTAGTTCCAATAAAGTGG - Intergenic
1089050516 11:115541147-115541169 AGAACTGAGTTCAAATCAACAGG + Intergenic
1091293555 11:134456448-134456470 AGAAACTAAGTTTAATCAAGCGG - Intergenic
1091387832 12:105875-105897 ACAGCCTAGGTCACATGAAGGGG - Intronic
1093323859 12:17748372-17748394 AGAGTCTAGGCCAAAACAAGAGG - Intergenic
1094539872 12:31354319-31354341 AGAACCTAGGGCAGGCCAAGAGG - Intergenic
1096828429 12:54296690-54296712 AGAACCCAGGTCAAAAGAAAAGG - Intronic
1103891508 12:124242455-124242477 AGACCATAGGTCAAAACCAGGGG - Intronic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1110473480 13:75886960-75886982 AGAGCCATGATCAAATCAAGAGG + Intergenic
1112241102 13:97682022-97682044 AGTACCCAAGTCATATCAAGGGG + Intergenic
1112737480 13:102437535-102437557 TGAACCAAGTTCAAATCAACTGG + Intergenic
1125255847 15:37761643-37761665 AGTACACAGGTTAAATCAAGTGG + Intergenic
1129632407 15:77275379-77275401 ACAACATGGGTTAAATCAAGTGG + Intronic
1134422901 16:14111327-14111349 AGAAGCTTGCTCACATCAAGTGG + Intronic
1141995100 16:87631759-87631781 AGAAACTAGATCAAAAAAAGAGG - Intronic
1147529698 17:41263924-41263946 AAAAACTATGGCAAATCAAGTGG - Intergenic
1147960527 17:44164745-44164767 AGAACCTCAGTCTAATCATGAGG - Intergenic
1150122437 17:62615490-62615512 AGAACTAGAGTCAAATCAAGAGG - Intergenic
1150360735 17:64531429-64531451 AGAAACTAAGTGAAATCATGGGG + Intronic
1152838743 17:82552630-82552652 CTAACCTAGATCTAATCAAGAGG - Intronic
1154102596 18:11489854-11489876 AGAACCTAGGTCCCTTCATGGGG + Intergenic
1158873658 18:61712377-61712399 AGAACCTAGGTATACTAAAGAGG + Intergenic
1158998621 18:62949978-62950000 AGAACCTATGTCAAAAAAAGCGG - Intronic
1161854065 19:6753702-6753724 GGAACCTAGGACAAATGCAGGGG + Intronic
927069083 2:19507146-19507168 AGAACTTAGATCAAAGAAAGTGG + Intergenic
935369785 2:102333136-102333158 AGAACCTAGGTCAAATCAAGGGG - Intronic
936282072 2:111150739-111150761 AGAACATAGCTCAAAATAAGTGG - Intronic
937726934 2:125177484-125177506 AGAACTTAGTTCAACTAAAGAGG + Intergenic
941236013 2:162975011-162975033 CAAACATGGGTCAAATCAAGTGG + Intergenic
941312072 2:163946108-163946130 AGACCCTAGGTAAAGACAAGGGG - Intergenic
943441487 2:187932782-187932804 AGGACTTAAGGCAAATCAAGGGG - Intergenic
944130710 2:196344920-196344942 AGAAAATGGGTCAAAGCAAGGGG + Intronic
945186886 2:207148358-207148380 AGACCCTAGGTCAAGTCGAGCGG - Intronic
945797350 2:214381290-214381312 AGATCCTTGATCAAATCAAGAGG + Intronic
946091405 2:217227248-217227270 AGAACCTAAATCTAATCAAGAGG - Intergenic
946711015 2:222505403-222505425 ACAACATGGGTTAAATCAAGTGG + Intronic
948956732 2:241298786-241298808 AAAACCTAGATCTAATCAAAAGG + Intronic
1171443843 20:25188846-25188868 AGAACTTATGTCTAACCAAGAGG - Intergenic
1183720659 22:39559774-39559796 AGAACTTTGGTCAAAGGAAGGGG - Intergenic
949926023 3:9042513-9042535 AGAACTTGGGGCAAATCAACAGG + Intronic
949974733 3:9445718-9445740 AGAACCTAGCTCATAGCAGGAGG + Exonic
951682004 3:25304667-25304689 ATAACCCAGGTGAAATCAAATGG - Intronic
953252650 3:41260733-41260755 GGGACCTGGGTCAAATCTAGGGG - Intronic
955742895 3:62111200-62111222 AGAAGTTAAGTCAAATCAACAGG + Intronic
959540239 3:107528909-107528931 AGAACATGGGTAAAAGCAAGGGG + Intronic
960790698 3:121427174-121427196 AGAATCAAGGTCTAATCATGAGG + Intergenic
962239024 3:133734748-133734770 ACAACCTGAGTCAAATCATGTGG + Intergenic
962863425 3:139425639-139425661 AGAATCTAGATGTAATCAAGAGG + Intergenic
966014187 3:175121262-175121284 AGAACCTAAGACAAGTCAGGTGG - Intronic
970454367 4:16207566-16207588 TGTACCTAGGTCATCTCAAGAGG - Intronic
973581348 4:52347394-52347416 AGAACCTAGGTATACTAAAGAGG - Intergenic
977290698 4:95161687-95161709 GGAACCTGGGTAAAATCAAAGGG - Intergenic
980495850 4:133586982-133587004 AGAACCTAAGGCAAATTTAGGGG + Intergenic
980710067 4:136554265-136554287 GGAATCAAGGTCAAATCAAAAGG - Intergenic
981438658 4:144756834-144756856 AGATCCTAAGTCAAAACAGGTGG - Intergenic
982188533 4:152827959-152827981 AGAACCTAGGCCAAGTGCAGTGG - Intronic
983041838 4:162937978-162938000 AGACCCTAAATCAAATAAAGAGG + Intergenic
996870949 5:128192789-128192811 AGAATCTACTTCAAGTCAAGTGG - Intergenic
998013725 5:138715974-138715996 AGAATCCAGGTCAAAACCAGAGG - Intronic
998100385 5:139428365-139428387 CCAGCCTAGGTAAAATCAAGTGG + Intronic
1001101976 5:168821809-168821831 AGAAACTTGCTCAAATTAAGTGG + Intronic
1003339457 6:5205697-5205719 AGAACCTGGTTCAAAGCAAGAGG + Intronic
1005590874 6:27325435-27325457 AGAAACTAGTCCAAATCATGAGG - Intergenic
1006646543 6:35518710-35518732 AGTACCTATGTCAGATCAAAAGG - Intergenic
1011070780 6:83380486-83380508 AGAACCTAGCTAAAAAAAAGTGG + Intronic
1011333946 6:86239263-86239285 AGAACTGAGTTCAAGTCAAGTGG - Intergenic
1011604268 6:89087046-89087068 AGAAAATAGGTCAGATCCAGAGG + Intergenic
1011892685 6:92186708-92186730 ATAAGCGAGGTCAGATCAAGAGG - Intergenic
1014988815 6:128048364-128048386 AGAAGGTGGGTCAAATCCAGGGG - Intronic
1021424463 7:20484010-20484032 AGAAGCAAGGTTAAATCAACTGG + Intergenic
1031176609 7:118360642-118360664 AGAAAAGAGGTCAAATCAATTGG + Intergenic
1031410076 7:121430934-121430956 ATAACCTAGGTCAAAATATGGGG - Intergenic
1031622637 7:123953604-123953626 AGAAGCTTTGTTAAATCAAGTGG + Exonic
1033820440 7:145128510-145128532 AGAAACTATGAGAAATCAAGAGG + Intergenic
1033829909 7:145239617-145239639 AGAAACTGGGTCAAATGACGAGG - Intergenic
1038547716 8:28438596-28438618 AGTACCTAGCTCAAAGCTAGTGG - Intronic
1041112010 8:54492036-54492058 ACAAACTGGGTCAAACCAAGAGG + Intergenic
1042370967 8:67990405-67990427 AGAACTTAGGTCAACTCCAATGG + Intronic
1043946306 8:86257297-86257319 AGAATCTAAGCCAAAGCAAGAGG + Intronic
1045684524 8:104698673-104698695 AGGACCTAGGTCAAAGGAACTGG - Intronic
1046228394 8:111317361-111317383 AGAACCTAGGCCAAATAAATTGG + Intergenic
1046925646 8:119784985-119785007 AGGGCCTAGGTGAAATTAAGAGG - Intronic
1049274502 8:141713042-141713064 AGACCCTAGGGGAAATCTAGGGG - Intergenic
1051669346 9:19494495-19494517 AAAAACTAGATCAAATCCAGGGG + Intergenic
1055780328 9:79814311-79814333 AGAACATAAGTCAAATAAAATGG - Intergenic
1057441871 9:95089284-95089306 AGAAACTAGCTCAGATCAAAGGG + Intergenic
1197820949 X:130540419-130540441 AGAACCTACGGAACATCAAGAGG - Intergenic
1198562972 X:137871303-137871325 AAACCCCAGATCAAATCAAGAGG - Intergenic
1199480628 X:148294818-148294840 AGAAGGTATCTCAAATCAAGGGG - Intergenic