ID: 935373331

View in Genome Browser
Species Human (GRCh38)
Location 2:102370161-102370183
Sequence CCTGCCATCCAGGAGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935373331_935373336 30 Left 935373331 2:102370161-102370183 CCTTGGAGCTCCTGGATGGCAGG 0: 1
1: 0
2: 6
3: 51
4: 392
Right 935373336 2:102370214-102370236 CCAGAGCAGTGTCCTGCACATGG 0: 1
1: 0
2: 5
3: 34
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935373331 Original CRISPR CCTGCCATCCAGGAGCTCCA AGG (reversed) Intronic
900340614 1:2187117-2187139 CCGGCCAGCCACGGGCTCCATGG - Intronic
900394492 1:2447599-2447621 CCTGCCTTCCAGTCTCTCCAGGG - Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900715674 1:4141944-4141966 CCTTCCTTTCTGGAGCTCCAGGG - Intergenic
900727649 1:4228290-4228312 CCTGCCACACAGGAACTCAAGGG - Intergenic
900764428 1:4494513-4494535 CCCCCCATCCAGGGGCTGCAGGG - Intergenic
901665832 1:10825716-10825738 CCTGCCATCCAGGAGGCTGAAGG + Intergenic
901849496 1:12006648-12006670 CTTGACATCCAGGACCTCCATGG + Exonic
902192744 1:14774980-14775002 CCTGCCCTCATGGAGCTCCCAGG + Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
902674487 1:17999339-17999361 CCTGCCATGGAGCAGCTTCATGG - Intergenic
903139483 1:21330589-21330611 TGTGCCTTCCAGGAGCTCCCAGG - Intronic
903145460 1:21369236-21369258 CCTGGCTGCCAGGAGCTCCTAGG - Intergenic
903389448 1:22953736-22953758 CCCGCCGCCCAGGAGCGCCACGG + Exonic
903474535 1:23610488-23610510 CCTGCCCTCAAGGAGCTCCTGGG - Intronic
903535648 1:24064526-24064548 CCCTCCATCCAGGAGCCCCCAGG - Intronic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
904918296 1:33986028-33986050 TCTGCCCTCAAGGAGCTCCCTGG - Intronic
904946994 1:34206674-34206696 TCAGCCCTCCATGAGCTCCAAGG - Intronic
905334117 1:37232313-37232335 CCTATAATCCAGGAGCCCCAGGG - Intergenic
906197398 1:43937383-43937405 CCTCCCATCCCGGAGCTGCTGGG - Intergenic
906243735 1:44258580-44258602 ACTGCCCTCAAGGAGCTCCCAGG + Intronic
906522647 1:46476608-46476630 CCTGCCTTCCAGCCCCTCCATGG - Intergenic
906689931 1:47785833-47785855 CCTGCCAACAGGGAGCTCCCAGG - Intronic
907480878 1:54744881-54744903 CCTGCCCTTGAGGAGCTCCCAGG + Intergenic
908511187 1:64851061-64851083 CCTACCCTCCAGGAGCTCAGAGG + Intronic
908640135 1:66213405-66213427 CCTGATATCCAGGTGTTCCATGG + Intronic
909342260 1:74545314-74545336 CCTGAGAACCAGGAGCACCAAGG - Intergenic
910425410 1:87115838-87115860 CCTTTCTTCCAGGAGCCCCAAGG + Intronic
910929039 1:92424167-92424189 CCTGCCTTCCAGGAGTTCACAGG + Intergenic
912487278 1:110039223-110039245 CAAGCCATCCAGGAGCCTCATGG - Exonic
913247822 1:116885691-116885713 CCTGCCCTCCAGGAGCTTCCAGG - Intergenic
915240954 1:154521363-154521385 CTTGCAATCCAGGAGCTGAATGG + Exonic
915281958 1:154829046-154829068 AATCCCATCCAGGAGCTCCCAGG + Intronic
915516432 1:156415526-156415548 GGGGCCATCCAGGAGCTCCCAGG - Intronic
917226495 1:172789073-172789095 ACTGCCTTTCAAGAGCTCCAGGG + Intergenic
917473231 1:175343888-175343910 CCTGCCTTCCAGTAACACCATGG - Intronic
918721187 1:187854074-187854096 CCTGCTATTCATGACCTCCATGG - Intergenic
920226911 1:204445955-204445977 CGTGGCATGCAGGAGCCCCAGGG + Exonic
920261289 1:204689706-204689728 CCTGCCCTCAGGGAGCTCCCAGG + Intergenic
920902914 1:210129447-210129469 CCGACCAACCAGCAGCTCCAGGG - Intronic
921486647 1:215723000-215723022 CTTGGCATGCAGGAGTTCCATGG - Intronic
922576830 1:226666424-226666446 CCTGGTGTCCAGGGGCTCCAGGG + Intronic
923536299 1:234854706-234854728 CCTGCCTTCAAGGAGCTCACAGG + Intergenic
923750847 1:236744969-236744991 CCTACCATCCAGCAGCACCCCGG + Intronic
924865154 1:247971299-247971321 CCTGCCAACCTGGATCTCGATGG - Intronic
1062835195 10:630889-630911 TCTGCCATCCCTGTGCTCCAAGG - Intronic
1062888681 10:1038948-1038970 CCTGCCCTCCACCTGCTCCATGG - Intergenic
1063598572 10:7459955-7459977 CCTGCCATTCAGCAGGGCCACGG + Intergenic
1065444358 10:25782309-25782331 CCTGCCCTCCAGCAGCTACTTGG + Intergenic
1067038918 10:42938374-42938396 CCTGCCTTCCAGGCCCTCCCTGG + Intergenic
1067794565 10:49311381-49311403 GCTGCCAGCCAGGAGCCCCGAGG + Intronic
1068770540 10:60815599-60815621 CCTGCCACCCATCAGCTCCATGG + Intergenic
1069726453 10:70583178-70583200 CCTTCCCCCCAGGAACTCCACGG - Intergenic
1069808163 10:71138842-71138864 CCTGCCACCCAGTCCCTCCATGG + Intergenic
1070156936 10:73841080-73841102 CCTGGCCTTCCGGAGCTCCATGG + Intronic
1073332940 10:102682630-102682652 CTTGCCATCTAGCAGCTCCATGG + Intronic
1074231229 10:111537920-111537942 CCTCCACTTCAGGAGCTCCATGG - Intergenic
1075017088 10:118917849-118917871 CCTGCCTTCAAGGAGCCCAAAGG - Intergenic
1075210288 10:120485238-120485260 CCTGCCTTCAGGGAGCTCTAGGG - Intronic
1075398157 10:122142594-122142616 CCTGCAATCTGGGAGCTCCCTGG + Intronic
1075547241 10:123364204-123364226 CCTGCCTTCAAGGGGCTCCCAGG + Intergenic
1075689889 10:124387672-124387694 CCTCCCATCCACGAAGTCCAAGG + Intergenic
1075747320 10:124736801-124736823 CCAGCTATCCAGGAGCTCGAGGG + Intronic
1076129615 10:128004195-128004217 CCTGGCATCCAAGATCCCCATGG - Intronic
1076265240 10:129104351-129104373 CCTGACATCCATGTCCTCCAGGG + Intergenic
1076548516 10:131261991-131262013 GGTGCCTTCCAGGAGCTGCAAGG + Intronic
1076830626 10:132992547-132992569 CCTGGCATCCAGGGTCCCCAGGG + Intergenic
1076872590 10:133201059-133201081 CCTGCCATCCAGGAGTGCACGGG - Intronic
1077013461 11:390076-390098 ATTGCCATCCAGGAACCCCAGGG + Intergenic
1077433073 11:2525678-2525700 CCAGCCTTCCAGGTGCTCCTGGG + Intronic
1078094486 11:8288368-8288390 CCTGGCATCTGGAAGCTCCAGGG - Intergenic
1078542211 11:12221738-12221760 CCTTTCAGCCAGCAGCTCCAGGG - Exonic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1079087456 11:17456885-17456907 CCTGACACCCAGGAGATGCACGG - Intronic
1081669415 11:44934799-44934821 CCTGCCTTCCAGGAGCCAAAGGG + Exonic
1081760909 11:45575852-45575874 CCTGCCCTCGAGGGGCTCCCAGG + Intergenic
1081777891 11:45688827-45688849 CCAGCCATCCCCGAGCTCCCAGG - Intergenic
1081858780 11:46320336-46320358 CCAGCCATCTGGGGGCTCCATGG - Exonic
1082783268 11:57302743-57302765 GCTGGCAGCCAGCAGCTCCAAGG - Exonic
1083518027 11:63278778-63278800 TCTGCCATCCAGGCGGTTCATGG + Intronic
1083793310 11:64999839-64999861 CCTGCCATGTAGGAGCTCATTGG - Intergenic
1084089113 11:66868920-66868942 CCTGTCCACCAGGAACTCCACGG + Exonic
1084956623 11:72695044-72695066 CCGGCGATCCAGGATCTCCAGGG + Exonic
1085340485 11:75728057-75728079 CCTGGCATCCAGGGCCTCCTGGG - Exonic
1085350995 11:75797793-75797815 CCTGCCTTCAGGGAGCACCAAGG + Intronic
1085351268 11:75799342-75799364 TCTTCCATCCAGCAGCTCCAAGG - Intronic
1088159675 11:106854579-106854601 CATGCCATCCAGGAGCCTGAGGG - Intronic
1089151864 11:116370612-116370634 CTTGCCATCAAGGAGCTCACGGG + Intergenic
1089346657 11:117795784-117795806 CCTGCCCTGCCGGTGCTCCAGGG - Intronic
1089368313 11:117934660-117934682 CCTGCCCTCCAGGACCTCCCAGG + Intergenic
1090036312 11:123252656-123252678 CCAGCCCTCCAGGAGCTTCCAGG - Intergenic
1090471309 11:126983704-126983726 GCTGGCATCCAGGTGCTGCAGGG - Intronic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1091657456 12:2355920-2355942 CCTGCCCTCTGGGAGCTCCCAGG - Intronic
1095343919 12:41126537-41126559 CCTGAAAACCAGGAGCACCAAGG + Intergenic
1095918024 12:47499538-47499560 CCTGCCTTACAAGAGCTCCTAGG + Intergenic
1095964339 12:47857044-47857066 CCTTCCATCCAGCAGCCCCAGGG + Intronic
1099933202 12:89097416-89097438 CCTTTTATCCAGGAGTTCCATGG + Intergenic
1100462100 12:94809817-94809839 CCTGCCCTCAAGGAGTTCCTTGG - Intergenic
1101591582 12:106129891-106129913 CCTGCTACCCAGGAGCTAGATGG - Intronic
1101957355 12:109222992-109223014 CCTGCCCTCCAGGTGCTCAGTGG + Intronic
1102050414 12:109857762-109857784 CCTGCCCTCCAGGAACAGCAGGG + Intronic
1102423834 12:112824936-112824958 CCTTCCTCCCAGGATCTCCAAGG + Intronic
1102960996 12:117093171-117093193 CCTGCCCTCCAGAAGCTCAGGGG - Intronic
1104718735 12:131033081-131033103 CCTGCCCTCCAGGACATTCATGG + Intronic
1106485817 13:30171632-30171654 CTTGCCTTCCTGGAGCTCCTTGG - Intergenic
1107670984 13:42746079-42746101 CCTTGCATTCAGCAGCTCCATGG + Intergenic
1108076002 13:46680353-46680375 CCTCCCACCCAGGAGCTCATAGG + Intronic
1108836541 13:54557034-54557056 CCTACCATCCAGCATCTACAAGG + Intergenic
1109199171 13:59411630-59411652 CTTGCCATCAAGGAGCTCCCAGG + Intergenic
1109508641 13:63338443-63338465 CCTCCATTCCAGGAGCTCCTGGG - Intergenic
1110348576 13:74478712-74478734 CCTGACAACTAGGAGCACCAAGG + Intergenic
1113518592 13:110921826-110921848 CCAGCCATGCAGAAGCACCAGGG + Intergenic
1113747429 13:112754842-112754864 CCAGCATTCCCGGAGCTCCATGG - Intronic
1114327742 14:21606372-21606394 CCTGCCAACCAGGATGCCCAGGG - Intergenic
1119435740 14:74596751-74596773 CCAGCCACCCAGGGGCTACAGGG - Intronic
1119947418 14:78709521-78709543 GTTGCCATCGAGGAGTTCCACGG - Exonic
1120648395 14:87100854-87100876 CCTGCCATCTAGGAAATCCAGGG - Intergenic
1121096661 14:91222124-91222146 CCTGCCCTCCAGCTGCTCCCTGG + Intronic
1121228232 14:92337304-92337326 CTTGCCCTCAAGGAGCTCAAAGG - Intronic
1121274157 14:92656511-92656533 CCTGCCAGCCAGCTGCCCCAAGG - Intronic
1121491203 14:94362254-94362276 AGTGCCATCCAAGGGCTCCAGGG + Intergenic
1121597331 14:95174449-95174471 GCTGCCCTCAAGGAGCTCCTAGG - Intergenic
1121653462 14:95576825-95576847 CCTGGCCCCCAGGGGCTCCAGGG + Intergenic
1122047892 14:99036329-99036351 CCTGGCATTCAAGGGCTCCATGG + Intergenic
1122055250 14:99093708-99093730 CCTGCCACGGAGGAGCTCCAAGG + Intergenic
1122084261 14:99288998-99289020 CATGGCCTCCAGGACCTCCATGG + Intergenic
1122195190 14:100079437-100079459 CCTGCCTTCAAGGAGCTCACAGG + Intronic
1122339340 14:101018233-101018255 CCTGCCTTCCAGGGGCTCAGAGG - Intergenic
1122406096 14:101502006-101502028 GCTGCCATCTAGAAGCACCAGGG + Intergenic
1122788197 14:104173581-104173603 CCTGTCATCCAGTGGCTCCTGGG + Intronic
1125880526 15:43190088-43190110 CATGCCATCCACGATGTCCAGGG - Exonic
1126111765 15:45179404-45179426 CCTGCCCTCCAGGAGCCACAGGG - Intronic
1126830083 15:52593028-52593050 CCAGCTATTTAGGAGCTCCAAGG + Intronic
1127166212 15:56246266-56246288 CCGGCCTTCCAGGACCTACAGGG + Intronic
1127604616 15:60573882-60573904 CCTGCCTTCAAGGAGCTCACAGG - Intronic
1128134909 15:65255604-65255626 CTTGCCCTCCAGGAGCTCCAGGG - Intronic
1128555847 15:68631153-68631175 CCGGCCATCCAGGTGTTCCCTGG - Intronic
1129277121 15:74453303-74453325 CCTGCCATCAAGGAACTCTTAGG + Intronic
1129672822 15:77616553-77616575 CCAGCAATCCAGGAACCCCATGG - Intronic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1130374022 15:83312163-83312185 CCTGCCCTCAGGGAGCTCCCTGG + Intergenic
1130515132 15:84620739-84620761 GCTGGCATCCAGAGGCTCCAGGG + Exonic
1131151456 15:90049810-90049832 CATCCCAGCCAGGAGCTCCTGGG - Intronic
1131597604 15:93813748-93813770 CCTGCCATCCAGGTGTTTCTGGG - Intergenic
1132577388 16:670282-670304 CCTGCGGTCGGGGAGCTCCATGG + Exonic
1132626775 16:895065-895087 CCTGCGTTCCAGGGGCTCCTGGG - Intronic
1132631666 16:920596-920618 CCTGCCTTCCACGAGCTCCTGGG - Intronic
1133389499 16:5397962-5397984 CCACCAATCCATGAGCTCCATGG - Intergenic
1134336663 16:13305966-13305988 CCTGCCCTCCAGAAGCTCATGGG + Intergenic
1135128027 16:19827777-19827799 CCTGCGAGCCAGGAGCACCAAGG - Intronic
1135566554 16:23515691-23515713 CCTGAAATCCAGGAGTACCAAGG - Intronic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1136683259 16:31979952-31979974 CCTGCCCTCAGGGTGCTCCAAGG + Intergenic
1136783892 16:32923508-32923530 CCTGCCCTCAGGGTGCTCCAAGG + Intergenic
1136885891 16:33930298-33930320 CCTGCCCTCAGGGTGCTCCAAGG - Intergenic
1137574590 16:49590551-49590573 CATCCCATACAGGAGCTCCAGGG + Intronic
1138175617 16:54895737-54895759 TCTGCCACCAAGGGGCTCCATGG - Intergenic
1138312920 16:56043306-56043328 CCTGCCCTCAAGGGACTCCATGG + Intergenic
1138424296 16:56920437-56920459 CCTGCCATCCAGCAACTAAAAGG - Intergenic
1138598206 16:58040677-58040699 CGTGGCATCCAGCAGCTCTACGG + Exonic
1138599578 16:58046683-58046705 TCTGCCACCCAGGATCCCCAAGG + Exonic
1139513331 16:67439553-67439575 CCTCCCACCCAGGAGTGCCAGGG + Intronic
1139849307 16:69940995-69941017 CAGGCCCTCCTGGAGCTCCAGGG - Exonic
1139954609 16:70687109-70687131 CCTTTCATCCAGGAACTCCTGGG + Intergenic
1140403567 16:74691916-74691938 ACTGCCTTCCAGGAGCTCACGGG - Intronic
1140814519 16:78608773-78608795 CCTGCCCTCCAGGGGTTCCTGGG + Intronic
1141151663 16:81568506-81568528 TGTGCCAGGCAGGAGCTCCAGGG + Intronic
1142172925 16:88632233-88632255 CTTCCCCTCCAGCAGCTCCACGG - Intergenic
1142314979 16:89338068-89338090 TCTGCCACTCAGGAGCCCCAGGG + Intronic
1203086550 16_KI270728v1_random:1187510-1187532 CCTGCCCTCAGGGTGCTCCAAGG + Intergenic
1142473331 17:175643-175665 CTTGCCCTCCAGGTGCTCCCAGG + Intronic
1142498981 17:321793-321815 CCTGCCATCCGCCAGCTCCTGGG + Intronic
1142880367 17:2878770-2878792 CCTGCTGCCCAGGAGCCCCACGG + Intronic
1143375142 17:6462903-6462925 ACTGCCTTCCATGGGCTCCAGGG - Intronic
1144956968 17:19023558-19023580 CCTTTCATCAAGGAGCCCCAAGG - Intronic
1145957677 17:28865745-28865767 GCTTCAAACCAGGAGCTCCATGG + Intergenic
1146272119 17:31491376-31491398 CCTGCCTTCAAGGAGCTCGCAGG + Intronic
1147144166 17:38475661-38475683 CCTGCCCTCAGGGTGCTCCAAGG + Intronic
1147449736 17:40496496-40496518 CTTGCTAACCAGGAGCTCCCAGG + Exonic
1148002552 17:44398300-44398322 GCTGCTATCCAGGGACTCCAGGG + Exonic
1148458328 17:47822844-47822866 TCTGGCATCCAGGAGCCTCAAGG + Intergenic
1148781994 17:50127716-50127738 CCTGCCATTCTTGAACTCCAGGG + Intronic
1148794709 17:50191454-50191476 CCTGGCTACCGGGAGCTCCAGGG + Exonic
1148945253 17:51256871-51256893 TCTGCCATTGAGTAGCTCCATGG - Intronic
1150653422 17:67024473-67024495 CCAGCCTTCCAGGGGCTTCACGG + Intronic
1150694115 17:67389516-67389538 CCTGCCCTCCTGAAGCTCCTAGG + Intronic
1151893762 17:76966641-76966663 CCTGCCCTCAGGGAGCTCCTGGG + Intergenic
1152217874 17:79044998-79045020 CCTGGCCTCCAGGAGCTCTGAGG + Intronic
1152698231 17:81806738-81806760 CCACCCAGCCAGGAGCTCCCTGG - Intronic
1154311036 18:13266314-13266336 CCTGCCCTCGAGGAGCTCCCAGG - Intronic
1156838860 18:41587623-41587645 CCTGCTATCAAGGAGCTTGATGG - Intergenic
1157003867 18:43559250-43559272 CCTGCCATCCAGGTGCTTCCTGG + Intergenic
1158488960 18:57893086-57893108 GCTGCCATCCAGGAGCCACCAGG - Intergenic
1158951245 18:62497444-62497466 CCTGCCCTCAAGGAGCTCATGGG + Intergenic
1160368514 18:78350178-78350200 CCTGCCACCAAGGCTCTCCAGGG - Intergenic
1161355390 19:3816588-3816610 CCTGCCATCTAGGAGCGCAAGGG + Intronic
1162150721 19:8643646-8643668 CCTGAGAGCCAGGAGCACCAGGG - Intergenic
1162867757 19:13561746-13561768 CCTGAGAACCAGGAGCACCAAGG - Intronic
1164638014 19:29805637-29805659 CCTGCCCTCCAGGAGCTCCCAGG - Intergenic
1164852019 19:31491941-31491963 CCTGCCCTCCAGTTGCTCCTTGG + Intergenic
1165060427 19:33202524-33202546 CCTGCCAGCCGGCACCTCCAAGG - Intronic
1165421593 19:35724757-35724779 CCTTCCCTCCAGGAGCTACCTGG + Intronic
1165907535 19:39203154-39203176 CCTGTCCCCCAAGAGCTCCAAGG - Intronic
1166034596 19:40158581-40158603 CCTCCCTTCCATGAGCTCGATGG + Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925003189 2:422511-422533 CCTGGGCTCCAGTAGCTCCATGG + Intergenic
925180637 2:1814887-1814909 CCTACAACCTAGGAGCTCCAGGG + Intronic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925617065 2:5753851-5753873 CCTGCCCTCCCTGGGCTCCATGG - Intergenic
925901267 2:8511021-8511043 CCAGCCATCCAGTAGCTCACAGG + Intergenic
926045993 2:9710022-9710044 CATGCAATCCAGGAGTTGCAGGG - Intergenic
926324376 2:11771655-11771677 GCTGCTCTCCAGCAGCTCCATGG - Exonic
926724027 2:15983655-15983677 CCTGTCTTCCAGGGGCTCCCAGG - Intergenic
927151302 2:20198061-20198083 TCTGCCCTCCAGGAGCACCCAGG + Intergenic
927697440 2:25247741-25247763 CCGGCCGTCCTGGAGCCCCAAGG + Exonic
927810154 2:26176007-26176029 CCTGCCCTCCAGGAGCCCTTAGG - Intronic
927854545 2:26519569-26519591 CCTGCCATCCAGGAACTTACAGG - Intronic
927883964 2:26707199-26707221 CCTGCATTCCAGCAGCCCCAGGG - Intronic
928231260 2:29500644-29500666 CTTGTCATCCAGGAACTTCATGG + Intronic
928245198 2:29620588-29620610 TCTGCCATTCAGCAGCTGCATGG + Intronic
929989283 2:46771733-46771755 CCTGCCTTCAAGGAGCTCCCAGG - Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
931808009 2:65826772-65826794 CCTGCCAGCCAGGAGCAACAGGG - Intergenic
932735522 2:74251726-74251748 GCTGCCAGCCAGGAACACCAAGG + Intronic
933575660 2:84064072-84064094 CCTGCCATGATGGGGCTCCAGGG - Intergenic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
935712534 2:105912116-105912138 CCTGAAAACCAGAAGCTCCAAGG - Intergenic
935800624 2:106691593-106691615 CCTGCCATGGAGGAGCTCGTTGG - Intergenic
937220771 2:120342264-120342286 GCTGCCATCAAGGAACTCCTTGG - Intergenic
937337890 2:121072885-121072907 CCTGCCAGCCTGGAGTTCCTGGG + Intergenic
937668503 2:124514562-124514584 ACTGCCTTCCAGGAGCTCATAGG + Intronic
937774808 2:125763450-125763472 CCTGCCCTCCAGGTGCCCCCTGG - Intergenic
937988723 2:127650446-127650468 CCTGCCACCCAGGAGATCTGAGG - Intronic
938701090 2:133880726-133880748 CCTGCCACCCAAGAGCTGCTAGG - Intergenic
938758206 2:134400009-134400031 CTTGCCATCAAGGGGCTCAAAGG - Intronic
939096042 2:137834570-137834592 CCTGCCGTCCAGGTGCAGCATGG - Intergenic
939625579 2:144473232-144473254 CCTCCCAACCAGGAACCCCATGG - Intronic
939719615 2:145632545-145632567 ACTTTCATCTAGGAGCTCCAAGG + Intergenic
943800009 2:192045766-192045788 CCTGCCACCCAGGAGCTGGCTGG - Intronic
945121109 2:206458236-206458258 CCTGGCATACAGGAGGTACATGG + Intronic
946007847 2:216540813-216540835 CCTGCCCTTGAGGAGCTCCCAGG - Intronic
946060550 2:216937312-216937334 TCTGCCTTCCAGAAGCTCCAGGG + Intergenic
946334307 2:219027342-219027364 CCTCCTAGCCAGGAGCCCCAGGG + Intronic
946483607 2:220079505-220079527 CCTGCCATGCAAGATCCCCAGGG - Intergenic
947840143 2:233202468-233202490 CCAGCCTCCCTGGAGCTCCATGG + Intronic
947942398 2:234069650-234069672 CCTGCCCTCCAGGGCATCCATGG + Intronic
947949492 2:234135160-234135182 CCTGTCATGCAGGTGCCCCATGG - Intergenic
948627051 2:239275788-239275810 CCTGCCTTCCAGGAGCTCACAGG + Intronic
948789536 2:240370175-240370197 CCAGACTTCCAGGAGCTCCAGGG + Intergenic
948897504 2:240934183-240934205 CCTGCCTTCCTGGTCCTCCAGGG + Intronic
1168798824 20:630769-630791 CCTGTCCTCCAGGAGCTCACTGG - Intergenic
1170162214 20:13325078-13325100 CCTTGCATCCAGGAGCTCCCTGG - Intergenic
1171189601 20:23149826-23149848 CCTGGGATGCAGGATCTCCAGGG + Intergenic
1172161572 20:32872441-32872463 CCTGCCATCCCAGAGCTCTCAGG + Intronic
1172782338 20:37444304-37444326 CCTGTCTTCCAGGAGCCCCCGGG + Intergenic
1175153639 20:56954736-56954758 CCTGCCATCCAGGGGCTTCGTGG - Intergenic
1175270749 20:57732228-57732250 CCTGCCTTCCACGAGCTGCCTGG + Intergenic
1175860910 20:62149527-62149549 CCTGCCCTCCTGCAGCTCCATGG - Intronic
1176110100 20:63407174-63407196 CGTGCGCTCCAGCAGCTCCACGG - Exonic
1176673732 21:9757699-9757721 CCTGTCATTCAGGAGCCCAAGGG + Intergenic
1177033340 21:16010966-16010988 CCTTTCATCCAGGAGCTAAAAGG - Intergenic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1177357459 21:20028005-20028027 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1177357629 21:20030395-20030417 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1178448902 21:32673339-32673361 GCTGGCATCCAGGAGTTTCAAGG - Exonic
1179800842 21:43810890-43810912 CCTGCCCTCTAGGACCTGCATGG + Intergenic
1179880228 21:44290544-44290566 CCTGCCCTGCAGGAGCACCCGGG + Intronic
1180083283 21:45496507-45496529 CCGGCCCCCCAGGACCTCCAGGG + Exonic
1182303222 22:29350403-29350425 CCTGACTTAGAGGAGCTCCAAGG - Intronic
1182357724 22:29729834-29729856 CCTACCATCCAGGGGCTCCTGGG + Exonic
1182839739 22:33379132-33379154 CCTGCCTTCCCAGAGGTCCATGG + Intronic
1183832214 22:40424279-40424301 CCTGCCAGCCATGAGTCCCAGGG - Exonic
1183987281 22:41576517-41576539 CCTGCCACCCAGGAGGCCCCAGG - Exonic
1184403574 22:44287416-44287438 CCTCCCAGCCAGGAGCTCCCAGG - Intronic
1184743027 22:46440015-46440037 CCTGCCCTTCAGGAGCTCACAGG - Intronic
1184810786 22:46830319-46830341 CCTACCCTCCAGGGGCTCGAAGG - Intronic
1185082481 22:48717730-48717752 TCTGCCCTCCAGGAGCCACACGG + Intronic
1185139531 22:49092592-49092614 CCTGGCACCCAGGAGCCCCCAGG + Intergenic
950199014 3:11029509-11029531 CCTGCCCTCCAGAGGCTCCCAGG + Intronic
950419922 3:12892663-12892685 CATCCCACCCAGGACCTCCATGG + Intergenic
950488146 3:13285006-13285028 CCTGCCTTTCAGGAGCTTCCAGG + Intergenic
951527725 3:23669889-23669911 CCTGCCTTCGAGGAGTTCCCAGG - Intergenic
951868426 3:27333593-27333615 CCTGCAACCCAGTAGCACCAGGG + Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952736352 3:36695270-36695292 CCAGCCCTCCAAGAGCTGCAAGG + Intergenic
953080027 3:39608320-39608342 CCTGCCATCCAGATGCTTCCTGG + Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953876013 3:46667322-46667344 GCTGCCATCCAGGAGGCCCCTGG + Intergenic
954181118 3:48882044-48882066 CCTCAGATCCAGGAGCTCAAGGG - Intronic
954422517 3:50426097-50426119 CCTGCCCTCCCAGAGCTCCCAGG - Intronic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
958860986 3:99445369-99445391 CCTGCCTCCCAGCTGCTCCAGGG + Intergenic
961330307 3:126134454-126134476 CCTGACCTCCAGGAACTCTAGGG + Intronic
961467309 3:127089731-127089753 CCTGCCCTCAAGGAACTCCCAGG + Intergenic
961809566 3:129514051-129514073 CCTGCCAGCCAGGCCCTCCTAGG - Intronic
962184893 3:133247802-133247824 CCTGCCCTCCAAGAGTTCCCAGG + Intronic
963139205 3:141933683-141933705 CCTGCCAGCCAGTATGTCCAGGG - Intergenic
964435138 3:156643487-156643509 CCTGCCAACCTAGAGCTTCAGGG + Intergenic
965610506 3:170538730-170538752 CCTGCCCTCCAGGAGCTCTCAGG + Intronic
967200795 3:187070820-187070842 CCTGCCCTCCAGGAGGTCACAGG - Intronic
967942890 3:194779925-194779947 CCTGTCCTCCTGGAGCTCCAAGG - Intergenic
968550738 4:1222437-1222459 GCTGCCCCCCAGCAGCTCCAGGG + Intronic
968568185 4:1326021-1326043 CCTGCCTTCCAGGGGCTCAGAGG - Intronic
968652629 4:1766276-1766298 CCTGCCACCCAGGAGATGAAAGG + Intergenic
968731675 4:2272038-2272060 CGTGCCATGCAGGGGCTCCAGGG - Intronic
969048666 4:4356909-4356931 CCTGCCTTCCAGCAGCTCACAGG - Intronic
969376128 4:6764507-6764529 CCTGACCTCCTAGAGCTCCATGG + Intergenic
969393864 4:6908589-6908611 CCTGCCAACCAGGAGCCCTGAGG - Intergenic
969467563 4:7366625-7366647 CCTCCCATGCAGCTGCTCCAAGG + Intronic
969630196 4:8331398-8331420 ACTGTCAGCCAGGAGCTCCTGGG + Intergenic
970177040 4:13349950-13349972 CCTGAGAACCAGTAGCTCCAAGG - Intergenic
970401237 4:15719757-15719779 TCTGCCTTCCAGCAGCCCCATGG + Intronic
970477193 4:16435595-16435617 CCTGAGAACCAGGAGCTCCAAGG + Intergenic
970499559 4:16663591-16663613 CTTGCCTTCAAGGAGCTTCACGG - Intronic
973943365 4:55932701-55932723 CCTGTCTTCCAGCAGCTCCTTGG - Intergenic
981209425 4:142085114-142085136 CCTGCCTTCTTGGAGCCCCAGGG - Intronic
984024232 4:174523297-174523319 CTTGCTCTCCAGGAACTCCAGGG + Intergenic
985201010 4:187485624-187485646 CCTGTAATCCAGGAGCTACAAGG - Intergenic
985341649 4:188960968-188960990 GCCCCCATCCAGGAGCACCAAGG - Intergenic
985400979 4:189593970-189593992 CCTGTCATTCAGGAGCCCAAGGG - Intergenic
986043685 5:4017330-4017352 CCTGCCATCCAGGAACACCAGGG + Intergenic
986292275 5:6409883-6409905 CCTGCCATCCAGGTGCACATGGG + Intergenic
986357289 5:6941219-6941241 CCTGGGATCCAGCAGATCCAGGG - Intergenic
986654726 5:9999792-9999814 CCTGCCATCCTGGTGTTCCCAGG - Intergenic
987118146 5:14742616-14742638 CCTGCCCTCAGAGAGCTCCAGGG - Intronic
987306215 5:16640283-16640305 CCTGAGAACCAGGTGCTCCAAGG + Intergenic
988997525 5:36728356-36728378 CTTGCCATCCAGCTGCTCCGTGG - Intergenic
989339141 5:40354546-40354568 CCTGCCATCCATGATGCCCATGG - Intergenic
990488772 5:56283802-56283824 CCTGGTATTCAGGAGATCCAGGG + Intergenic
990608179 5:57430925-57430947 TCTGCCAGGCAGGACCTCCATGG + Intergenic
992275273 5:75110021-75110043 GTTACCATCCAAGAGCTCCAGGG + Intronic
993710289 5:91217500-91217522 CCTGGCTTCCTGTAGCTCCAGGG + Intergenic
994730132 5:103481869-103481891 CCTGCCATCCAGTGGATTCAAGG + Intergenic
995051932 5:107716833-107716855 CCTTCCCTCCAGAAGCACCAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995830889 5:116354415-116354437 CCTGAGAACCAGGAGCACCAAGG - Intronic
995926930 5:117386022-117386044 CTTGCCATCCATGAGCTCTCTGG + Intergenic
996458272 5:123710012-123710034 CATGCCATACAGCAGTTCCATGG - Intergenic
997505022 5:134410660-134410682 CCTGCCTTCTAGGTGCTCCTGGG - Intronic
998038909 5:138938332-138938354 CCTGACATTGAGGTGCTCCAGGG + Intergenic
999112520 5:149134399-149134421 TCTACCTTCCAGGGGCTCCAGGG - Intergenic
999144918 5:149385958-149385980 CCTGCCACCCATGAGCCCCCAGG - Intronic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
999274624 5:150321239-150321261 CCTGGCATACAGGAGGACCAAGG + Intronic
1000344573 5:160304043-160304065 CCTGCCACCCAGGTGTCCCAGGG - Intronic
1000351283 5:160354856-160354878 CCGGCCCCCCAGGAGCCCCAGGG - Exonic
1000614072 5:163408631-163408653 CCTGCCATCTAGTGGCTACATGG + Intergenic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1001073430 5:168606240-168606262 CCTGGCACTCAGGTGCTCCATGG - Intergenic
1001573592 5:172747213-172747235 CCTATCCTCCAGGAGCTCCAAGG + Intergenic
1002131458 5:177084476-177084498 CCTGCCTTGCTGGAGCTCCCAGG - Intergenic
1002774850 6:320066-320088 CCAGCCATGCAGGAGTTCTAGGG - Intronic
1003198911 6:3940900-3940922 CCTGCCATCCAGTGGCGTCAGGG - Intergenic
1003351870 6:5325392-5325414 CCTGCCATCCAGTGGCGGCAGGG + Intronic
1004080933 6:12392629-12392651 CATGACATCCTGCAGCTCCACGG - Intergenic
1004258156 6:14084118-14084140 CCTCCCAGGCAGGAGCTTCAAGG - Intergenic
1004721608 6:18272606-18272628 CCTGAGAACCAGGAGCACCAAGG - Intergenic
1006078301 6:31548376-31548398 CCTGCCCACCAGGACCGCCATGG + Exonic
1006097795 6:31666541-31666563 CCTGGCCTTCGGGAGCTCCAGGG + Intronic
1006670026 6:35724449-35724471 CAAGGCATGCAGGAGCTCCAAGG + Intronic
1007450253 6:41936654-41936676 CCCGCCATCCATGATCGCCACGG - Exonic
1010882096 6:81189964-81189986 CCTGACATCCAGAATTTCCAAGG + Intergenic
1013174430 6:107665223-107665245 CCTTGCATTCAGGAGCTCCAAGG - Intergenic
1013430283 6:110049452-110049474 CCTGCCCTCAAGTAGCTCCAGGG + Intergenic
1014132065 6:117846241-117846263 CCTGCCATCCAGGTTCTTCTTGG - Intergenic
1017032780 6:150238654-150238676 CCTGCCTTCCAGGAGCTCCCAGG - Intronic
1017581516 6:155869824-155869846 CTTGCCATCAAGGAACTCTAAGG + Intergenic
1018218733 6:161557779-161557801 CCAGCCATCCAGGAGCTATGTGG + Intronic
1018919419 6:168161113-168161135 TCTGCCCTCCGGGTGCTCCAAGG - Intergenic
1019145837 6:169975190-169975212 TCTGCCCTTCAGGAGCTACAGGG - Intergenic
1019597210 7:1863691-1863713 CCCTCCACCCAGGAGCTCCAGGG - Intronic
1019789487 7:3001743-3001765 CCTGCAATCCAAGAGCTCTCTGG + Intronic
1020026708 7:4904813-4904835 CCCTCCCTCCAGGAGCTCCCAGG + Intergenic
1022495451 7:30850301-30850323 CCTGCAGCCCAGGAGCCCCAAGG - Intronic
1022763366 7:33381360-33381382 TCTGCCCTCAAGGAGCTCCCAGG - Intronic
1023661417 7:42474870-42474892 CTTGCATTCCAGGAGCTCCAGGG - Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1024945325 7:54802302-54802324 CGTGCCAGCCAGGAGCTGCTTGG - Intergenic
1024950450 7:54855478-54855500 TCTCCCATCCAGGAGTTACATGG + Intergenic
1028142987 7:87291934-87291956 CCTGCCATCTAGGTGCTTCCTGG - Intergenic
1028753663 7:94410499-94410521 CCGGCCCTCCAGGACCTCCTGGG + Exonic
1028824301 7:95252077-95252099 CTTGCCATCCAAGTTCTCCATGG - Exonic
1029807199 7:103010024-103010046 CCTGCCATCCAGGTGTTTCCTGG - Intronic
1029807281 7:103010440-103010462 CCTGCCATCCAGGTGTTTCCAGG - Intronic
1031985245 7:128160232-128160254 CTTGCCTTCCAGGAGCTCAGAGG + Intergenic
1033136862 7:138792672-138792694 CCTGCCATCTCGGATCTCCTGGG + Intronic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1034940192 7:155225652-155225674 CCTGCCATCCAGAAGCACAGAGG + Intergenic
1035287629 7:157816378-157816400 CCTCCCCTCCACGAGCTCTAGGG + Intronic
1036685992 8:10910665-10910687 CCTCCCCTCAAGGAGTTCCAAGG + Intronic
1037121301 8:15290470-15290492 CCAGCCATCCAGGGGGCCCAAGG + Intergenic
1038407965 8:27335966-27335988 CCTGCACCCCAGGAGATCCATGG - Intronic
1038686560 8:29724240-29724262 CCTCCCATCCAGGTGCAGCACGG + Intergenic
1039336048 8:36590616-36590638 CCTGTCATCCCAGAACTCCAAGG + Intergenic
1039704080 8:39989546-39989568 CCTGACAGCCAGAAGCTCCCTGG - Intronic
1040286612 8:46103715-46103737 TCTGCCATCCAGAAGCCCCCAGG - Intergenic
1041220736 8:55648632-55648654 CCTGCCATTCAGGTGCTTCCTGG + Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1042523424 8:69738900-69738922 CCTGCCATCTATGTGCTTCAAGG + Intronic
1044834629 8:96283723-96283745 CCAGCTGCCCAGGAGCTCCAGGG - Intronic
1045676642 8:104614893-104614915 CCTGCCATCCAGATGCTTCTTGG + Intronic
1045699657 8:104850961-104850983 CCACCCATCCAGGAGCAACACGG - Intronic
1046260289 8:111758854-111758876 CCTGCCGTGCCGGAGCCCCAGGG - Intergenic
1047753566 8:127900839-127900861 CCTGCCTTCCAGAAGTTCCCAGG - Intergenic
1047795340 8:128249510-128249532 CCTGCCTTCCAGGAGTTTCAGGG + Intergenic
1047961479 8:130015151-130015173 ACATCCATCCAGGATCTCCAGGG - Intronic
1048027432 8:130599473-130599495 CCTGCCTTCAAGGGTCTCCAAGG - Intergenic
1048937866 8:139371768-139371790 CCTGCCTTCGAGGAGATCCCAGG + Intergenic
1049095992 8:140548446-140548468 CCTGACATCAAAGAGCTCCACGG + Intronic
1049165309 8:141122010-141122032 CCTGCCAGCCTGGTGCTCCTGGG + Intronic
1049275156 8:141716686-141716708 CCTGCCACCCAGCAGCTCTAAGG + Intergenic
1049399493 8:142418602-142418624 CCCGCCCACCAGGAGCTTCAGGG - Intergenic
1049540911 8:143208354-143208376 CCTGCCTTCCAGGGACTGCAGGG + Intergenic
1051440283 9:17075711-17075733 CCTGAGAGCCAGGAGCACCAAGG + Intergenic
1051795531 9:20865088-20865110 CCTGCCTTCTAGAAGCTCAAAGG + Intronic
1053345056 9:37371891-37371913 CCTGCCCTCGAGGAGCTCCCAGG - Intergenic
1053425686 9:38008568-38008590 ACTTCCATCCTGGAGCTCCTGGG - Intronic
1054766546 9:69047150-69047172 CCTGCCAACCAGTATCTGCATGG + Intronic
1055080087 9:72260123-72260145 CCTTCCATCCAGAAGCTTCTTGG - Intergenic
1055502019 9:76910568-76910590 CCTGCCCTCAAGGAGCTCACAGG + Intergenic
1056402223 9:86239556-86239578 CCAGCCATCCAGGCCCTTCAGGG - Intronic
1056877616 9:90349685-90349707 TCTGCCATCCAGGTGCTTCCTGG - Intergenic
1057204659 9:93164083-93164105 CCTGCCATCCAGCTTCTCCCTGG + Intergenic
1058420847 9:104831747-104831769 CCTCTCATCCAGCAGCTCCATGG + Exonic
1058719600 9:107751626-107751648 CTTGCCATCAGGGAGCTTCATGG + Intergenic
1058876582 9:109250003-109250025 CCTCCCACCCCGTAGCTCCAGGG - Intronic
1058923399 9:109639795-109639817 CCTGCCCTGCAGGAGCTCACGGG - Intergenic
1060135910 9:121153588-121153610 ACTGCCTTCAAGGAGCTCCTGGG - Intronic
1060780185 9:126406201-126406223 CCTGCCTTCAAGGAGCCTCAGGG + Intronic
1060802998 9:126556665-126556687 GCTGCCATCCTGGGGCTCCTGGG - Intergenic
1061163761 9:128910909-128910931 TCTGCCATGCAGCAGCCCCACGG + Intronic
1061257516 9:129461020-129461042 CCTGCCCTCCAGGAGCCCCTGGG + Intergenic
1061811512 9:133164818-133164840 CCTGCCTTACAGGAACCCCAAGG - Intergenic
1062028035 9:134349514-134349536 CCTGCCCGCCACGAGCTTCAGGG - Intronic
1062516649 9:136940212-136940234 CCTGTCCTCCATGACCTCCAGGG - Intronic
1185458182 X:320688-320710 CCTCCAATCCAGGCGCTGCAGGG - Intergenic
1185612054 X:1398709-1398731 CCAGCCCTCCAGGAGTTCTAGGG - Intergenic
1187152801 X:16696409-16696431 CCTGCTCTCCAGGAGCTCATTGG - Intronic
1189873015 X:45404363-45404385 CCTGCCATCCAGGTGCTTCTTGG - Intergenic
1190369386 X:49726794-49726816 CCTGCCTCCCACCAGCTCCAAGG - Intergenic
1190389351 X:49916760-49916782 CCTGCCATCAAGGAGCTTGCAGG + Intergenic
1192451892 X:71249949-71249971 CCTCCCATCCTGGGGCTGCAGGG - Intronic
1194356908 X:92896500-92896522 CCTGGCTTCCAGTAACTCCAGGG - Intergenic
1196140169 X:112252855-112252877 CCTGGGATCCAGGATCACCAAGG - Intergenic
1197501273 X:127244595-127244617 CCTGGCTCCCAGCAGCTCCATGG + Intergenic
1197678664 X:129358714-129358736 CCTGAGAACCAGGAGCACCAAGG + Intergenic
1198189362 X:134287556-134287578 CCTGGCTGCCAGCAGCTCCATGG - Intergenic
1200665241 Y:6013494-6013516 CCTGGCTTCCAGTAACTCCAGGG - Intergenic