ID: 935373845

View in Genome Browser
Species Human (GRCh38)
Location 2:102375406-102375428
Sequence GAGGGTGTCAAAGGTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935373845 Original CRISPR GAGGGTGTCAAAGGTGTGGG TGG Intronic
900363790 1:2302294-2302316 GAGCGAGGCAAAGGTGTGTGTGG + Intronic
900843835 1:5080142-5080164 GAGGGTGACAAATGTGAGTGTGG - Intergenic
900911118 1:5597712-5597734 GATGGTGTGCAAGGTGCGGGGGG - Intergenic
902716408 1:18275880-18275902 GAAGGGGGCAAAGGAGTGGGAGG - Intronic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
904272934 1:29362297-29362319 GAGGCTCTCAAAGGTGAAGGCGG + Intergenic
904592962 1:31625466-31625488 GAGGGAGTCAGACCTGTGGGAGG + Intronic
905665502 1:39760980-39761002 GAGGGAGGCCAGGGTGTGGGAGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906198965 1:43947274-43947296 GAGGGAGTCACAGGGGAGGGAGG - Exonic
906262730 1:44406212-44406234 GCGGGTGTGAAGGGTGTGGAGGG + Intronic
907272884 1:53301008-53301030 GAGGGTGCTCGAGGTGTGGGGGG + Intronic
910690137 1:89957200-89957222 GAGGGTGTCAAAGCTGTCCCTGG + Intergenic
910841586 1:91566871-91566893 GGGGGTGACAGCGGTGTGGGGGG + Intergenic
915413912 1:155725329-155725351 GTGGGTGTGGAAGGAGTGGGTGG - Intronic
915558408 1:156672995-156673017 GAGGGTGCCTGAGGTGTGGGGGG + Exonic
915762008 1:158323798-158323820 GAGGGTGCCCAAGCTGTGTGAGG + Intergenic
916472181 1:165135124-165135146 TAGAGTCGCAAAGGTGTGGGAGG - Intergenic
916611488 1:166396338-166396360 GAGGGGATCAAATGTGTTGGTGG + Intergenic
917497396 1:175553291-175553313 GAGGGTGGAAAAAGTGTTGGTGG - Intronic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
920335859 1:205244711-205244733 AAGGGTGACAAAGGAGTTGGGGG + Intronic
921728718 1:218553113-218553135 GTGGGTGTCTAAGGTTGGGGCGG - Intergenic
923250314 1:232174400-232174422 GAGGAAGGGAAAGGTGTGGGAGG + Intergenic
923633682 1:235673562-235673584 GTGGGTGTGACAGTTGTGGGGGG - Intronic
1062904810 10:1172829-1172851 TAGGGTCTCACAGGTGTGGGGGG - Intergenic
1064288425 10:14012483-14012505 CAGGGTGTGAAAGGGGTGGCGGG + Intronic
1065050592 10:21787748-21787770 GTAGGTGTCTAAGGTGTTGGTGG - Intronic
1068274176 10:54771077-54771099 GAGTGTGTCAATAGTGTGGTAGG - Intronic
1068443972 10:57096102-57096124 GAGGATGTCACAGATGTGGCTGG - Intergenic
1068964788 10:62901281-62901303 GAGGGTTTCAAATCAGTGGGAGG - Intronic
1069428359 10:68310612-68310634 GTGGTTGTCAGAGGTGGGGGTGG - Intronic
1069990071 10:72309740-72309762 GGGGGTGTTGAAGGTGGGGGTGG - Intergenic
1070915898 10:80154559-80154581 GAGGTTGGAAAAGGAGTGGGTGG + Exonic
1070925819 10:80220860-80220882 GGGGGTGTCTATGGTGGGGGAGG - Intergenic
1071371074 10:84952418-84952440 GAGGGAGTGCTAGGTGTGGGTGG + Intergenic
1072165645 10:92810234-92810256 GAGGCAATCAAAGGTGTTGGGGG + Intergenic
1073191153 10:101651327-101651349 GAGGGTGGGAAATGGGTGGGGGG + Intronic
1073234444 10:102001923-102001945 CAGGAAGTCAAAGGTGTGGCAGG - Intronic
1076762374 10:132611902-132611924 GAGGGTGTGGGAGGTGAGGGGGG + Intronic
1079923501 11:26461430-26461452 GAAGGTGTGAAAGGAGTGGGGGG - Intronic
1081224469 11:40502954-40502976 GAAGTTGTCAACGTTGTGGGTGG - Intronic
1081547383 11:44081086-44081108 GGGGGTGTCAGAAGGGTGGGAGG + Intronic
1082029347 11:47593608-47593630 GAGCAGGTCAGAGGTGTGGGAGG + Intronic
1083600889 11:63946941-63946963 GAGGGTCTCCAAGCTGTGGAGGG - Exonic
1084183457 11:67457895-67457917 GAGGGTGTGGAAGGTGTGCATGG + Intronic
1084668886 11:70593583-70593605 GGGGGTGTTGTAGGTGTGGGAGG - Intronic
1087586531 11:100128797-100128819 GGGGGTGGCATAGGAGTGGGTGG - Intronic
1088789339 11:113210736-113210758 GTATGTGTCCAAGGTGTGGGTGG - Intronic
1090063067 11:123480377-123480399 GAGGGTGTGAGATGTGTGGGAGG - Intergenic
1091153998 11:133356746-133356768 CACGGTGTCACAGGTGTGGCAGG + Intronic
1091155862 11:133372010-133372032 GAGGCTGAGAAGGGTGTGGGGGG + Intronic
1091213793 11:133887082-133887104 GATGTTTTCATAGGTGTGGGAGG - Intergenic
1092343244 12:7694134-7694156 GAGGGTGTAAAAGGTGAGACTGG + Intronic
1092824174 12:12382277-12382299 GAGGGAGACAGAGGTGGGGGAGG + Intronic
1095982598 12:47981668-47981690 GAGGGTGACAGTGGTGAGGGAGG + Intronic
1096233406 12:49910007-49910029 GGGAGGGGCAAAGGTGTGGGCGG + Intergenic
1096619873 12:52857545-52857567 CGGGGTGTCAATGGTGAGGGAGG - Intergenic
1099484023 12:83205908-83205930 GAGGCTGGGAAAGGTGTTGGTGG - Intergenic
1099844115 12:88006876-88006898 GAGGTGGTGAAAGGAGTGGGTGG + Intronic
1100127241 12:91442222-91442244 GAGGGTGACAAAGGAGTGATGGG + Intergenic
1102028543 12:109727107-109727129 GAGGGGGTGTAAGGTGTGGCAGG - Intronic
1102096614 12:110246314-110246336 GAGGGTGTCAAAGGCCTGTAAGG - Intergenic
1102157527 12:110742902-110742924 GAGGCTGTCTAAGGAGTCGGCGG - Exonic
1102719286 12:115002465-115002487 CAGGGTGGCAAAGGTGGAGGTGG - Intergenic
1103428261 12:120857807-120857829 GAGCCTGTCACAGGGGTGGGTGG + Intronic
1103951981 12:124556241-124556263 GAGGGGGCCACAGGTGAGGGAGG + Intronic
1103968154 12:124653110-124653132 GATGGAGTCACTGGTGTGGGTGG - Intergenic
1105547767 13:21364349-21364371 GTGGTTGCCAAAGGTGGGGGCGG - Intergenic
1106096199 13:26646517-26646539 GGGAGTGACACAGGTGTGGGGGG - Intronic
1106120961 13:26859879-26859901 GAGGGTGGCAAAGAGTTGGGTGG - Intergenic
1108336306 13:49444770-49444792 GAGGTTGTCAAAGGGGCGGCAGG + Exonic
1109717790 13:66239268-66239290 GAAGGTGTGTAAGGTCTGGGAGG + Intergenic
1112391123 13:98985289-98985311 GAGGATGTTACAGGTGGGGGTGG - Intronic
1113577085 13:111402481-111402503 GATGGTGGCAAAAGTGTGAGAGG + Intergenic
1114332412 14:21650766-21650788 GAGGGTATCAAAGCAGTGGAAGG - Intergenic
1114508641 14:23237898-23237920 GGCGGTGTGAGAGGTGTGGGCGG - Intronic
1115515019 14:34176413-34176435 GAGGGAGTCAGAGGTTGGGGTGG - Intronic
1115834555 14:37385184-37385206 GAGGGTGTGTAAGGTTGGGGTGG + Intronic
1118169321 14:63371037-63371059 CAGGGTGTCACAGGTGGGGCAGG - Intergenic
1118874350 14:69770675-69770697 GACACTGCCAAAGGTGTGGGGGG - Intronic
1119213340 14:72849454-72849476 GATGCTGTCCAAGATGTGGGCGG - Intronic
1119371201 14:74145323-74145345 GAGGTTGGCAAAGGTTTGGAGGG - Intronic
1119738742 14:77000258-77000280 GAGGGAGGCACAGGGGTGGGTGG + Intergenic
1119941773 14:78648876-78648898 GAGGGTGGGAAGGGAGTGGGCGG + Intronic
1121723788 14:96131188-96131210 GAGGGTGTCAAAGTAGGGGGAGG + Intergenic
1121826497 14:97014074-97014096 GAGGGTGCCAGATGTGTGTGTGG + Intergenic
1122053322 14:99074927-99074949 GGGGGTCTCAGAGGTGAGGGAGG - Intergenic
1122324409 14:100874139-100874161 CAGGGAGTCAAAGCAGTGGGTGG + Intergenic
1122967942 14:105139971-105139993 GCGGGTGTCATAGGTGGGGCTGG - Intergenic
1127295064 15:57601930-57601952 GAGGGTGGCAATGGTGTACGTGG + Intronic
1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG + Intronic
1131248320 15:90814800-90814822 TAGGCTGCCGAAGGTGTGGGTGG + Intronic
1132221625 15:100109474-100109496 GAGGGTGTGAAGGGAGGGGGAGG + Intronic
1132688408 16:1171758-1171780 GAGGGTGGCAAAGTTGTGGACGG - Intronic
1132871531 16:2117691-2117713 GAGGGTGTCAACGGTCAGTGTGG + Intronic
1133924014 16:10180040-10180062 GATGGGGACGAAGGTGTGGGAGG + Exonic
1134134505 16:11669891-11669913 GGGGGTGTCATGGGTGGGGGTGG + Intronic
1134418056 16:14061727-14061749 GAGAGAGTCAAAGGAGGGGGAGG + Intergenic
1134520998 16:14919204-14919226 GAGGGTGTCAACGGTCAGTGTGG - Intronic
1134550574 16:15136769-15136791 GAGGGTGTCAACGGTCAGTGTGG + Intronic
1134708674 16:16317855-16317877 GAGGGTGTCAACGGTCAGTGTGG - Intergenic
1134715887 16:16357888-16357910 GAGGGTGTCAACGGTCAGTGTGG - Intergenic
1134950930 16:18350790-18350812 GAGGGTGTCAACGGTCAGTGTGG + Intergenic
1134958869 16:18394271-18394293 GAGGGTGTCAACGGTCAGTGTGG + Intergenic
1135155728 16:20051280-20051302 GAGGGTGTGCATTGTGTGGGAGG - Intronic
1135685351 16:24494362-24494384 GATGGTGTCACAGGTGAGGGGGG - Intergenic
1138519484 16:57562976-57562998 GCGTGTGACAGAGGTGTGGGTGG + Intronic
1139657562 16:68398055-68398077 GAGGGAGTCCAAGAGGTGGGTGG + Intronic
1140139405 16:72240961-72240983 GAGAGTGGCAAAGGTGCAGGTGG + Intergenic
1140140631 16:72253595-72253617 GAGGGTGTTATAGGTATTGGTGG - Intergenic
1140443143 16:75001965-75001987 AAGGGTGTCAAAAGTGTGTATGG + Intronic
1142518417 17:489109-489131 GGGGGTACCTAAGGTGTGGGGGG + Intergenic
1143705837 17:8697180-8697202 GAGGAAGGCAAAGGTGGGGGAGG + Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1145907065 17:28522014-28522036 GTGGGTGTCAAAGTTGGGGTAGG - Intronic
1146185995 17:30724589-30724611 GCGGGAGTCAGAGGTGTTGGAGG + Intergenic
1146352675 17:32108905-32108927 GAGGGAGGCAAAGGTGTGTGTGG + Intergenic
1146616107 17:34358650-34358672 GGGGCTCTCAGAGGTGTGGGTGG + Intergenic
1147376084 17:40023176-40023198 CAGGGTGTCAAAGATGTGGATGG + Exonic
1148764374 17:50028675-50028697 CAGGGGGTCCAAGGTGTGAGGGG - Intergenic
1150757361 17:67926889-67926911 GAGGGAGGCAAAGGTGGGTGTGG - Intronic
1151477216 17:74350902-74350924 GAAGGTGTCCAGGGTTTGGGGGG + Exonic
1151601755 17:75110231-75110253 GAGGGTGGGAAAGGTGCAGGGGG - Exonic
1152377452 17:79926128-79926150 GAGGGTGGCAAAGGAGAGTGGGG - Intergenic
1152470059 17:80486120-80486142 GAGGGTCTCAAAGCTGGGTGGGG + Intergenic
1152968749 18:141225-141247 GGGGATGTCAATGGTGTGGATGG + Intergenic
1153800810 18:8666769-8666791 GAGGGTCTCACAGGTGTGAGTGG + Intergenic
1156192922 18:34740543-34740565 TATGGTCTCAAAAGTGTGGGAGG + Intronic
1156449767 18:37260426-37260448 GATGGTGTCCAAGCTGTGGTGGG + Intronic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1157901444 18:51522370-51522392 GAGGGTCTGAAATGTGTGGCTGG - Intergenic
1160328788 18:77973770-77973792 GAGGGTGGCACAGCTGTGCGGGG + Intergenic
1160366167 18:78327780-78327802 GAGGCTGTGGACGGTGTGGGAGG - Intergenic
1161031415 19:2059492-2059514 GTGGGAGTGAAAGGTGGGGGTGG + Intergenic
1161114871 19:2491097-2491119 GAAGGGCTCCAAGGTGTGGGGGG + Intergenic
1161537962 19:4831554-4831576 GAAGGTGTCGGGGGTGTGGGGGG - Intronic
1161594488 19:5144221-5144243 GAGGGTGCGGAGGGTGTGGGGGG - Intronic
1161716158 19:5877262-5877284 TAGGGTGGGGAAGGTGTGGGGGG - Intronic
1161723788 19:5917222-5917244 CAGGGTGGGAAGGGTGTGGGTGG + Exonic
1161885895 19:6995372-6995394 GATGGTGTCAATGGTGATGGTGG + Intergenic
1162332607 19:10039386-10039408 TATGGTGAGAAAGGTGTGGGTGG + Intergenic
1162972782 19:14191142-14191164 GCGGGAGTCAGAGGTGTTGGAGG - Intronic
1163237508 19:16038068-16038090 GAGAGTGTAAAAGGTGCAGGGGG + Intergenic
1163758187 19:19119473-19119495 GAGGGGAGCAAAGGTCTGGGAGG - Intronic
1164189476 19:22901489-22901511 GGGGGTGTTCGAGGTGTGGGAGG + Intergenic
1164433485 19:28208288-28208310 GACCATGTCAAAGGTGGGGGTGG + Intergenic
1164720745 19:30430032-30430054 GAGGGTGTGAAGGGTGGGGGAGG + Intronic
1167308829 19:48724512-48724534 GTGGGTGTTAAAGGTATGAGAGG + Intronic
1168592962 19:57652105-57652127 GAGGGTGAGATAGGTGTGTGGGG - Intergenic
1202637203 1_KI270706v1_random:52807-52829 GAGGGAGTGAAAGGTGAGGGTGG - Intergenic
925095860 2:1201383-1201405 GAGGCTGGAAAGGGTGTGGGGGG + Intronic
925649504 2:6074164-6074186 GAGGGAGTCAGAGGTAGGGGAGG + Intergenic
926188499 2:10709709-10709731 GAGGGTGTCAAAGGCATCTGTGG - Intergenic
927151921 2:20201122-20201144 GAGGATGTCCAAGGTGTCTGCGG + Exonic
927897336 2:26792259-26792281 GAGGGTGGCATAGGGGTTGGTGG - Intronic
928033094 2:27797983-27798005 GAGGTTGTCATGGGAGTGGGAGG + Intronic
930967510 2:57348186-57348208 GAGTTTGTAAAAGGTGTAGGGGG + Intergenic
931401241 2:61933371-61933393 CAGGGTGGCAGGGGTGTGGGGGG + Intronic
932110591 2:68995533-68995555 GAAGGTGTCTATGGTGTGGGAGG + Intergenic
933850272 2:86361131-86361153 CAGGGAGCCCAAGGTGTGGGAGG + Intergenic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
937152431 2:119695253-119695275 CTGGGTGTGAAAGGTGGGGGAGG - Intergenic
938902281 2:135808433-135808455 GAGGCTTTGAAAGGTGTGTGAGG - Exonic
939617354 2:144376367-144376389 AAGGGTGTCAAGGGGGTGAGAGG + Intergenic
939965386 2:148605409-148605431 GAGGGTGTCCAAAATGTGTGGGG + Intergenic
940151415 2:150606581-150606603 GAGGCTCTCAGAGCTGTGGGGGG - Intergenic
940822924 2:158377264-158377286 GGGTGTGTCGATGGTGTGGGGGG + Intronic
941068758 2:160932468-160932490 GAGGGAGCCAAAGGAGTGAGTGG + Intergenic
944291051 2:198005662-198005684 GAATGTGTAACAGGTGTGGGCGG + Intronic
946757134 2:222959274-222959296 CAGGGATTCAAAGGTCTGGGTGG - Intergenic
1170485583 20:16812643-16812665 GAGGTGTTCAAAGGTGTGGTTGG + Intergenic
1170569593 20:17625356-17625378 GTGGGGGTCCAGGGTGTGGGGGG - Intronic
1171268905 20:23798327-23798349 CACGGTGTGAAAGGTGTGGCAGG - Intergenic
1171878380 20:30598746-30598768 GTGGGTGTCCCAGGGGTGGGTGG - Intergenic
1173222955 20:41144488-41144510 GAGTGTGGGAAAGGTCTGGGTGG - Intronic
1174401905 20:50280492-50280514 GAGGGAGTCAATGGTGATGGTGG + Intergenic
1176250113 20:64116615-64116637 GAGGTGGACAGAGGTGTGGGAGG + Intergenic
1176360971 21:5996088-5996110 GTGGGTGTCCACGGTGTTGGTGG + Intergenic
1176426570 21:6552424-6552446 GAGGGTGGAGAAGGGGTGGGAGG - Intergenic
1178980244 21:37257753-37257775 GAGGGTACCAGAGGCGTGGGAGG + Intronic
1179413442 21:41179397-41179419 GAGGGTGTCCAGGGTGAGTGAGG + Intronic
1179702061 21:43160746-43160768 GAGGGTGGAGAAGGGGTGGGAGG - Intronic
1179721094 21:43316392-43316414 GAGGGTGTCGGGGGTGTCGGAGG + Intergenic
1179762547 21:43542462-43542484 GTGGGTGTCCACGGTGTTGGTGG - Intronic
1179890078 21:44330924-44330946 GAGGGAGACAAAGGCGTGTGAGG + Intronic
1180104005 21:45605386-45605408 GTGGGTGTCCACGGTGTTGGTGG + Intergenic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1180796461 22:18608192-18608214 GAGTGTGTCGAAGGTGACGGTGG + Exonic
1180880023 22:19197105-19197127 GAGAGTGTCAGAGGCGTGTGGGG - Intronic
1181225262 22:21387079-21387101 GAGTGTGTCGAAGGTGACGGTGG - Exonic
1181253370 22:21547734-21547756 GAGTGTGTCGAAGGTGACGGTGG + Exonic
1181325770 22:22044713-22044735 GTGGGGGGCAAAGATGTGGGGGG - Intergenic
1182738283 22:32546820-32546842 GAGGGAGGCAAGGGTGTGGGTGG - Intronic
1183069017 22:35383257-35383279 GAGGGTGTGGCAGGTGTGGGTGG + Intronic
1184991692 22:48174621-48174643 GAGGCTGTCAGTGGTGTAGGAGG - Intergenic
1185151692 22:49167473-49167495 GAGGGTGTGAAAGGTGGGAGGGG - Intergenic
1185304100 22:50103027-50103049 GAGCGGGTCACAGGTGTGGCGGG + Intronic
951555506 3:23917092-23917114 GAGGGTGGCTGAGGTGGGGGAGG + Exonic
953986694 3:47449368-47449390 GAGGTAGTCACAGTTGTGGGAGG - Intronic
955622206 3:60877010-60877032 GTGGGTGTCCAAGGTGTTGGTGG - Intronic
957814902 3:85284726-85284748 GAGGGTGTGAGAGAAGTGGGTGG + Intronic
958902955 3:99909405-99909427 GAGGGGGTCTGGGGTGTGGGTGG + Intronic
958961622 3:100515832-100515854 GAGGCTGGGAAGGGTGTGGGAGG + Intronic
959326524 3:104944523-104944545 GAGTGGGTCAATGGTGTGGGGGG + Intergenic
959400197 3:105891348-105891370 GTGTGTGGTAAAGGTGTGGGCGG - Intergenic
960811722 3:121632784-121632806 GAGAATGTAAAAGGTGTGAGGGG + Intronic
961236792 3:125374805-125374827 GCGGGTGTCAGAGGTAGGGGAGG - Intronic
962410031 3:135132951-135132973 CTGGATGTCAAAGGTGTAGGGGG - Exonic
962728527 3:138258144-138258166 GGGGGTGTCAAGGCAGTGGGTGG - Intronic
963049383 3:141128319-141128341 CAGGGCGTGACAGGTGTGGGTGG + Intronic
964428058 3:156574073-156574095 AAGGGTGAAACAGGTGTGGGTGG - Intergenic
964941190 3:162158910-162158932 GAGAGTGGAAAAGGGGTGGGAGG + Intergenic
965765758 3:172128482-172128504 TGGGGTCTCAAAGGTGTGTGTGG + Intronic
967471358 3:189865526-189865548 GAGGGTGCCAAAGGTGTTGGGGG + Intronic
968563299 4:1296150-1296172 GAGGGGGGCACAGGTGCGGGTGG - Intronic
968563356 4:1296351-1296373 GAGGGGGGCACAGGTGCGGGTGG - Intronic
968774900 4:2534990-2535012 TTGGGTGTCAGAGGTGTGTGAGG + Intronic
968983403 4:3863036-3863058 GAGGTTGCAAAAGGTGGGGGTGG + Intergenic
971217755 4:24676875-24676897 GAGGCTGGAAAAGGTGTGGGTGG - Intergenic
971800891 4:31289231-31289253 GAGGTTATCAAAGATATGGGAGG - Intergenic
972354672 4:38269281-38269303 GGAGGTGTCAAAGGCGTGGCAGG + Intergenic
973393601 4:49576258-49576280 GTGGGAGTGAAAGGTGAGGGTGG + Intergenic
974412429 4:61559222-61559244 GAAGATGTCAATGGTTTGGGTGG - Intronic
975735888 4:77380652-77380674 GAGGGAGTCGAAGCTGTGGGAGG + Intronic
978262038 4:106771507-106771529 GAGGGTGTGAAGGGTGGTGGAGG + Intergenic
983587805 4:169374997-169375019 GTAGGTGTCAAAGGTGTTGATGG - Intergenic
983845701 4:172514919-172514941 GGGAGTGTCCAAGGTGTGAGAGG - Intronic
986469740 5:8061859-8061881 GAGGGTGTGTAAGGGGTGTGGGG - Intergenic
986509766 5:8491771-8491793 CAGGGTGTCAAACTTGTGGATGG + Intergenic
989714190 5:44440812-44440834 GAGGGTGGGAAAGTTGAGGGTGG - Intergenic
991377812 5:65984492-65984514 GAGGGTGCCAGAGGCCTGGGTGG - Intronic
992328123 5:75684273-75684295 GGTGTTTTCAAAGGTGTGGGAGG - Intronic
993751281 5:91671475-91671497 GAGAGTGTCAGAAGTCTGGGCGG - Intergenic
993813606 5:92513320-92513342 GTGTGAGTCACAGGTGTGGGTGG + Intergenic
994026034 5:95085051-95085073 GAGGGTGTCAACAGAGTAGGAGG - Intronic
997091769 5:130866513-130866535 GGAGGTGCCAAATGTGTGGGTGG - Intergenic
998103292 5:139451786-139451808 GAGGGTGGGTATGGTGTGGGTGG + Intronic
999149915 5:149420068-149420090 TGGGGTGTCAAGGGGGTGGGAGG + Intergenic
999325779 5:150642517-150642539 CTTGGTGTCAAAGGTGGGGGTGG - Intronic
999766409 5:154744303-154744325 GAGAGTGTCATAGGTGAGAGTGG - Intronic
1003403899 6:5812320-5812342 GTGGTTGCCAAAGGTGGGGGTGG + Intergenic
1003761936 6:9188498-9188520 GTGGCTGTCAGAGGTGGGGGAGG - Intergenic
1004235341 6:13870648-13870670 GAGGGTGTCTGGGGAGTGGGGGG + Intergenic
1005360137 6:25023823-25023845 GAGGATGTCAGGGGTGTTGGGGG + Intronic
1005695762 6:28351322-28351344 GAGGGTGTCCACGGTGGGGAAGG - Intronic
1006947084 6:37791735-37791757 GAGGGTGGCCAGGGTGTAGGAGG - Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1011890939 6:92159088-92159110 GTGGGTGACAATGGTGGGGGGGG + Intergenic
1015287294 6:131501343-131501365 GACTGTGTCACAGGTGTGGTTGG + Intergenic
1017384262 6:153864741-153864763 GAGGCTGTGAATGGTGTGGAGGG + Intergenic
1018132879 6:160749351-160749373 GAGGGTGACAATGGTGGTGGTGG - Intronic
1019491576 7:1316253-1316275 GTGGGTGGCCAAGGTGAGGGGGG + Intergenic
1019743022 7:2684504-2684526 GATGGGGTCAAAGTTGGGGGCGG + Intronic
1019934875 7:4247647-4247669 GGGGGTGTCATAGCTGTGGGTGG + Intronic
1020881058 7:13763889-13763911 GAGGCTGTCCAAGTTGTGGCTGG - Intergenic
1021805418 7:24349825-24349847 TAGGGTGGCAAAGGTGCGGATGG + Intergenic
1023735655 7:43234172-43234194 CAGGGTGGGAGAGGTGTGGGTGG - Intronic
1024714993 7:52068938-52068960 GGGGGTGTCTAAGGTTTTGGGGG + Intergenic
1026084684 7:67253548-67253570 GATGGAGTCAGAGATGTGGGAGG + Intergenic
1026505478 7:70979254-70979276 GATGGAGCCAAAGGTGGGGGTGG + Intergenic
1026692484 7:72561373-72561395 GATGGAGTCAGAGATGTGGGAGG - Intronic
1026794817 7:73359419-73359441 GAGGGTGACCAAGGTCAGGGAGG - Intergenic
1027750822 7:82143043-82143065 GTGGGTGTCAGTGGTGAGGGGGG + Intronic
1029368130 7:100129369-100129391 GAGGTTGTCCAAGGTGCTGGAGG - Intergenic
1029424149 7:100486192-100486214 GAGGGTGGCAGAGGGTTGGGGGG - Intronic
1031266977 7:119593307-119593329 AAGGGTGTCCAGTGTGTGGGAGG + Intergenic
1031727356 7:125257817-125257839 GAGGGTCACACACGTGTGGGAGG - Intergenic
1033347790 7:140539295-140539317 GAGAGTTTCAAAGCTGGGGGAGG + Intronic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1035770379 8:2142599-2142621 GAGGGTGTCCAAGGGGTGACGGG - Intronic
1035797419 8:2371105-2371127 GAGGGTGTCAGAGCGGTAGGAGG + Intergenic
1037539479 8:19857419-19857441 GTGGGTGTCAAAAATGAGGGAGG - Intergenic
1037612500 8:20488098-20488120 GATGGTGTCAAAGATGGGCGCGG + Intergenic
1038864633 8:31426539-31426561 GCTGGTGTCAGAGGTGAGGGTGG - Intergenic
1045402602 8:101834188-101834210 GAGGGTGTGAAATGTGTGCAAGG + Intronic
1046782439 8:118230099-118230121 GAGGGAGTAAAAGGAGTAGGAGG + Intronic
1048444962 8:134486371-134486393 GACGGTGACAGAGGTGTCGGTGG - Intronic
1049021453 8:139960279-139960301 TTGGGTGTCCAAGCTGTGGGAGG - Intronic
1049369816 8:142258920-142258942 AGGGGTGTCCAAGGTGTGTGTGG + Intronic
1049756718 8:144314092-144314114 GGGGGTGTCAAGGCGGTGGGGGG - Intronic
1049766249 8:144356562-144356584 GAGGGTGTGACAGGTGGGAGAGG + Intronic
1051112076 9:13650752-13650774 GAGCCTGTCAAGGGGGTGGGAGG - Intergenic
1051156473 9:14152848-14152870 GGGGTTGTCAGAGGTGGGGGAGG + Intronic
1053150295 9:35738952-35738974 GAGGGTGCAAAAGTTGAGGGAGG + Intronic
1054729949 9:68691418-68691440 GAGAGTGTGAAAGTAGTGGGTGG - Intergenic
1056025152 9:82486261-82486283 GATGGTGGCAAGGGTGAGGGTGG + Intergenic
1058424509 9:104864738-104864760 CAGGGTGGCAGAAGTGTGGGAGG + Intronic
1060188816 9:121579523-121579545 GGGGCTGGCAAAGGTGTGGGTGG - Intronic
1060872960 9:127057352-127057374 AAGGGAGTTACAGGTGTGGGAGG + Intronic
1061712629 9:132498553-132498575 CAGGGTGGCACAGGAGTGGGTGG - Intronic
1061882994 9:133577335-133577357 GAGGAAGCCAGAGGTGTGGGCGG + Intergenic
1062011489 9:134269343-134269365 GTGGGTGGAAAGGGTGTGGGTGG + Intergenic
1062378888 9:136277302-136277324 GTGGGTGTGAACGGGGTGGGTGG + Intergenic
1062672783 9:137721382-137721404 GAGGGGGTGAGAGGCGTGGGAGG - Intronic
1187185338 X:16979230-16979252 TAGGGTGTCAAGTATGTGGGAGG + Intronic
1189277325 X:39796436-39796458 AAGGGTGACAAAGGTGTGAGTGG + Intergenic
1189326873 X:40117987-40118009 GAGGGAGGAAAAGGGGTGGGGGG - Intronic
1190690480 X:52909361-52909383 GAGGGTTTCAAAGGGGTTCGAGG + Intergenic
1190695503 X:52946431-52946453 GAGGGTTTCAAAGGGGTTCGAGG - Intronic
1195558248 X:106251977-106251999 GAGGCTGTGAAAGGTGTTGCAGG - Intergenic
1196755618 X:119154985-119155007 AAGGCTGGCAAAGGTGTGGGTGG + Intergenic
1200142729 X:153909935-153909957 GAGGGGGTCCAAGCTGTGGGAGG + Intronic